Anisostephus betulinus

(Kieffer, 1889) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Cecidomyiidae/Anisostephus

At a glance

Occurrence records612

Data sources6

Biological traits0

DNA specimens7

eDNA detections54

Sources6 archives

Databases and archives Anisostephus betulinus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility612 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI54 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF612 records

Environmental DNA5 datasets · 3 countries54 detections

DNA & barcodingBOLD7 specimens

01Narrative

De berkenbladblaargalmug is een muggensoort uit de familie van de galmuggen (Cecidomyiidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1889 door Jean-Jacques Kieffer.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anisostephus betulinus has left across the world's sequence archives.

At a glance

DNA specimens7

BINs1

Marker genes1

eDNA detections54

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 78% of positions are identical in every specimen.

Where individuals differ — all 145 variable positions, in barcode order

1Tmostly conserved

3Cmostly conserved

4Amostly conserved

5Tmostly conserved

7Amostly conserved

8Tmostly conserved

9Amostly conserved

10Tmostly conserved

11Tmostly conserved

14Amostly conserved

15Tmostly conserved

16Tvariable

17Tmostly conserved

18Tmostly conserved

19Tmostly conserved

25Tvariable

26Tmostly conserved

27Gmostly conserved

28Amostly conserved

29Gmostly conserved

30Cmostly conserved

32Gmostly conserved

33Gmostly conserved

34Amostly conserved

35Amostly conserved

36Tmostly conserved

37Amostly conserved

38Avariable

40Tvariable

41Gmostly conserved

45Cmostly conserved

47Tmostly conserved

48Cmostly conserved

50Tmostly conserved

52Amostly conserved

53Amostly conserved

56Amostly conserved

58Tvariable

59Cvariable

60Tmostly conserved

61Tvariable

62Amostly conserved

64Tmostly conserved

65Cmostly conserved

68Tmostly conserved

69Tmostly conserved

71Gmostly conserved

72Amostly conserved

73Amostly conserved

75Tmostly conserved

76Amostly conserved

81Cmostly conserved

82Avariable

83Amostly conserved

85Tmostly conserved

86Tmostly conserved

87Cmostly conserved

89Amostly conserved

90Amostly conserved

91Tmostly conserved

92Tmostly conserved

100Gmostly conserved

103Tmostly conserved

115Tmostly conserved

121Amostly conserved

127Tmostly conserved

130Tmostly conserved

133Tmostly conserved

163Amostly conserved

181Amostly conserved

187Cmostly conserved

190Amostly conserved

197Tmostly conserved

212Cmostly conserved

214Amostly conserved

220Cmostly conserved

226Cmostly conserved

229Amostly conserved

232Tmostly conserved

238Tmostly conserved

250Tmostly conserved

265Amostly conserved

266Tmostly conserved

268Amostly conserved

271Cmostly conserved

274Tvariable

277Tmostly conserved

278Tmostly conserved

281Tmostly conserved

282Tmostly conserved

283Tmostly conserved

286Amostly conserved

287Tmostly conserved

289Amostly conserved

307Tmostly conserved

316Tmostly conserved

325Gmostly conserved

343Tmostly conserved

346Tmostly conserved

347Cmostly conserved

367Tmostly conserved

373Amostly conserved

388Cmostly conserved

391Tmostly conserved

400Tmostly conserved

401Tmostly conserved

406Tmostly conserved

409Tmostly conserved

412Amostly conserved

415Tmostly conserved

421Cmostly conserved

433Amostly conserved

451Tmostly conserved

458Tmostly conserved

460Amostly conserved

487Tmostly conserved

490Cmostly conserved

496Tmostly conserved

499Tmostly conserved

500Tmostly conserved

+25 more variable positions not shown

TACATTATATTTTATTTTTGGAATTTGAGCAGGAATAATTGGAACTTCTTTAAGAATTCTTATTCGATTAGAATTAAGAACAATTTCTAA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)6.6%

Haplotypes3

BIN1

Most divergent pair0.30%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Feltiella acarisugasame family9.3%Asteromyia carboniferasame family9.6%Macrodiplosis pustularissame family10.8%Procontarinia mangiferaesame family10.9%Dasineura plicatrixsame family11.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type612 records

Wild obs. + sensor205

Museum / vouchered407

Range

Area of Occupancy AOO1 288 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy59% within 1 km

≤100 m 85≤1 km 31≤10 km 81

197 georeferenced · 8 without coordinates

Open the mapobservation + sensor205

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 395≤1 km 7

402 georeferenced · 5 without coordinates

Open the institutions mapphysical evidence407

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Stockholm, SE	3
DFFW2018location not on record	1

2 institutions · 4 of 407 vouchered records shown · 403 without an institution code

09Environmental DNA54 detections

Where the DNA of Anisostephus betulinus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found54

Studies independent surveys5

Countries3

Verifiable raw sequence linked47

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 54 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.6 °C 11.2–16.0

Seasonal swing summer↔winter18.5 °C

Max temp (day)17.7 °C 15.7–19.1

Min temp (night)9.70 °C 6.60–12.0

Precipitation76.3 mm/mo 60.4–98.4

Air humidity59.3 % 56.7–60.8

Moisture balance-32.0 mm/mo -48.1–-6.30

Vapour deficit635 Pa 553–720

Wind speed2.80 m/s 2.30–3.90

Cloud cover47.2 % 41.6–54.7

CHELSA 1981–2010, ~9 km grid, at location & month of 53 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)