Anisopteromalus calandrae

(Howard, 1881) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Pteromalidae/Anisopteromalus

At a glance

Occurrence records131

Data sources8

Biological traits0

DNA specimens30

eDNA detections27

Sources8 archives

Databases and archives Anisopteromalus calandrae's data was compiled from.

GBIFGlobal Biodiversity Information Facility131 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI27 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics30 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF131 records

Environmental DNA1 datasets · 8 countries27 detections

DNA & barcodingBOLD30 specimens

Genome at a glanceGoaT · TreeOfSex2n = 14

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding30 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anisopteromalus calandrae has left across the world's sequence archives.

At a glance

DNA specimens30

BINs1

Marker genes2

eDNA detections27

Countries9

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus23 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 90% of positions are identical in every specimen.

Where individuals differ — all 62 variable positions, in barcode order

43Gmostly conserved

49Tmostly conserved

52Amostly conserved

55Gmostly conserved

64Tmostly conserved

85Amostly conserved

88Amostly conserved

118Tmostly conserved

154Cmostly conserved

160Tmostly conserved

163Gmostly conserved

166Amostly conserved

169Tmostly conserved

175Amostly conserved

178Amostly conserved

181Gmostly conserved

190Tmostly conserved

196Cmostly conserved

202Tmostly conserved

217Gmostly conserved

220Gmostly conserved

229Gmostly conserved

235Cmostly conserved

238Cmostly conserved

253Amostly conserved

268Tmostly conserved

290Gmostly conserved

295Amostly conserved

298Tmostly conserved

307Tmostly conserved

313Gmostly conserved

316Gmostly conserved

319Tmostly conserved

322Gmostly conserved

343Cmostly conserved

346Amostly conserved

370Gmostly conserved

373Amostly conserved

376Amostly conserved

379Tmostly conserved

400Amostly conserved

401Tmostly conserved

412Tmostly conserved

415Gmostly conserved

416Amostly conserved

421Cmostly conserved

424Amostly conserved

442Cvariable

456Tvariable

490Tmostly conserved

505Amostly conserved

511Gmostly conserved

520Amostly conserved

536Cmostly conserved

568Cmostly conserved

574Gvariable

583Tmostly conserved

589Tmostly conserved

616Tmostly conserved

619Tmostly conserved

622Gmostly conserved

631Amostly conserved

TATTTTATATTTTATTTTTGGGATATGAGCTGGAATTATAGGGTTATCTATAAGGATAATTATTCGTATAGAATTAGGTAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.2%

Haplotypes7

BIN1

Most divergent pair8.9%

AsiaOtherN.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Quadrastichus ventricosussame order12.0%Trigonoderus filatussame family12.1%Sphaeripalpus fuscipessame family12.4%Pteromalus pontaniaesame family12.7%Achrysocharoides cillasame order12.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5PCYTB

animal barcodemitochondrial

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_058228 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND1CYTBND6ND4LND4ND5COX1COX2ATP8ATP6COX3ND3ND212S ribosomal RNA16S ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT · TreeOfSex

The complete instruction manual Anisopteromalus calandrae carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 14 n = 7

Chromosome records14–142n range14median14mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 72×GoaT · Animal Chromosome Counts Database · GoaT · Tree of Sex Database

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Tree of Sex Database — ↗

2n 142×GoaT · Tree of Sex Database · TreeOfSex · invert

GoaT · Tree of Sex Database — ↗

TreeOfSex · invert — Gokhman, V. E., & Quicke, D. L. (1995). The last twenty years of parasitic Hymenoptera karyology: an update and phylogenetic implications. J. Hym. Res, 4, 41-63. ↗

08Occurrence & distribution

Record type131 records

Wild obs. + sensor6

Museum / vouchered125

Range

Area of Occupancy AOO136 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy60% within 1 km

≤1 km 3>10 km 2

5 georeferenced · 1 without coordinates

Open the mapobservation + sensor6

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy5% within 1 km

≤100 m 1≤1 km 2≤10 km 59>10 km 4

66 georeferenced · 59 without coordinates

Open the institutions mapphysical evidence125

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Champaign, US	44
DPIlocation not on record	24
Zürich, CH	21
Honolulu, US	16
Agricultural Research Council-Plant Protection Research Institutelocation not on record	12
University of Guelph, Centre for Biodiversity Genomicslocation not on record	1
Riverside, US	1
CUlocation not on record	1

8 institutions · 120 of 125 vouchered records shown · 3 without an institution code

09Environmental DNA27 detections

Where the DNA of Anisopteromalus calandrae was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found27

Studies independent surveys1

Countries8

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 27 detections have coordinates

Open the map8 countries0

farm8. Desert | 8.1. Hot DesertKnob Thorn/MarulaÂ Savannah1. Forest & Woodland | 1.6. Subtropical/Trop…Corn3. Shrubland|3.5. Subtropical/Tropical Dry S…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.8 °C 17.2–30.2

Seasonal swing summer↔winter21.0 °C

Max temp (day)29.7 °C 20.6–35.2

Min temp (night)19.0 °C 13.3–25.0

Precipitation93.3 mm/mo 22.1–208

Air humidity58.0 % 45.4–63.8

Moisture balance-71.0 mm/mo -136–88.1

Vapour deficit1,334 Pa 843–1,966

Wind speed2.70 m/s 2.00–3.50

Cloud cover32.7 % 12.9–41.8

CHELSA 1981–2010, ~9 km grid, at location & month of 14 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)