Anisoptera laevis

Ridl. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malvales/Dipterocarpaceae/Anisoptera

At a glance

Occurrence records78

Data sources12

Biological traits12

DNA specimens18

eDNA detections10

Sources12 archives

Databases and archives Anisoptera laevis's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility78 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics18 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources12 traits

Occurrence & distributionGBIF78 records

Environmental DNA1 datasets · 1 countries10 detections

DNA & barcodingBOLD · NCBI18 specimens

Genome at a glanceCCDB · GoaT418 Mbp

01Narrative

Anisoptera laevis is a tree in the family Dipterocarpaceae. The specific epithet laevis means "smooth", referring to the leaves.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Life cycle & reproduction3

Deciduousnessevergreen

Life formtree

Life spanperennial

Habitat & environment5

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formtree

Woodinesswoody

Physiology & chemistry3

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Wood density519 mg/cm³

Other traits1

Plant support typefree-standing

05DNA & barcoding18 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anisoptera laevis has left across the world's sequence archives.

At a glance

DNA specimens18

Marker genes2

GenBank sequences7

eDNA detections10

Countries2

The DNA barcodea real sequence read deposited for this species

rbcLKJ594583.1 ↗504 bpSingapore · 2009

ACGT

AAGTGTTGGATTCAAAGCCGGTGTTAAAGAGTATAAATTGACTTATTATACTCCTGACTACCAAACCAAAGATACTGATATCTTGGCAGC …

Anisoptera laevis voucher BT_0067701973 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL4

plant barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Anisoptera laevis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size417 606 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Anisoptera laevis0.42 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidy2× diploid · measured

Chromosome records22–222n range22median22mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 222×GoaT · Kew Plant DNA C-values Database · CCDB · book-ipcn67-71

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · book-ipcn67-71 — JONG, K . & A. LETHBRIDGE. 1967. Cytological studies in the Dipterocarpaceae, I. Chromosome numbers of certain Malaysian genera. Notes Roy. Bot. Gard. Edinburgh 27: 175-184.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=0.988 ↗

08Occurrence & distribution

Record type78 records

Wild obs. + sensor31

Museum / vouchered47

Range

Area of Occupancy AOO124 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy97% within 1 km

≤1 km 30>10 km 1

31 georeferenced

Open the mapobservation + sensor31

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 3

3 georeferenced · 44 without coordinates

Open the institutions mapphysical evidence47

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Universiti Brunei Darussalam, Herbariumlocation not on record	9
Kew, GB	4
Xiamen, CN	3
Bronx, US	2

4 institutions · 18 of 47 vouchered records shown · 29 without an institution code

09Environmental DNA10 detections

Where the DNA of Anisoptera laevis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found10

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 10 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.3 °C 26.3–26.3

Seasonal swing summer↔winter1.10 °C

Max temp (day)30.1 °C

Min temp (night)22.8 °C

Precipitation330 mm/mo

Air humidity69.8 %

Moisture balance183 mm/mo

Vapour deficit1,035 Pa

Wind speed0.9 m/s

Cloud cover48.8 %

CHELSA 1981–2010, ~9 km grid, at location & month of 9 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)