Anisoptera costata

Korth. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malvales/Dipterocarpaceae/Anisoptera

At a glance

Occurrence records252

Data sources11

Biological traits21

DNA specimens6

eDNA detections5

Sources11 archives

Databases and archives Anisoptera costata's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility252 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources21 traits

Occurrence & distributionGBIF252 records

Environmental DNA1 datasets · 1 countries5 detections

DNA & barcodingBOLD · NCBI6 specimens

Genome at a glanceCCDB · GoaT488 Mbp

01Narrative

Anisoptera costata is an endangered species of plant in the family Dipterocarpaceae. The name costata is derived from Latin (costatus = ribbed) and describes the prominent venation of the leaf blade. A huge emergent tree up to 65 m high, it is found in evergreen and semi-evergreen lowland tropical seasonal forests of Indo-Burma and in mixed dipterocarp forests of Malesia.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology4

Plant height40 m

⚠ sources differ — GIFT: 40 m · TRY: 37.5 m

Seed mass685 mg

Seed mass max830 mg

Seed mass min540 mg

Life cycle & reproduction6

Deciduousnessevergreen

Dispersal typewind

Life formtree

Life spanperennial

Pollination modebiotic

Pollination syndromeinsect

Habitat & environment5

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formtree

Woodinesswoody

Physiology & chemistry6

Leaf n26.8 mg/g

Leaf p1.51 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)13.02 mm²/mg

Wood density565 mg/cm³

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anisoptera costata has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes3

GenBank sequences10

eDNA detections5

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMH410673.1 ↗841 bpMalaysia · 2016

ACGT

GGACGCGACGAGGGGCGGTTCGCCGCCCGCGACGTCGCGAGAAGTCCACTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGT …

Anisoptera costata isolate MPKS small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK6★rbcL2★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Anisoptera costata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size488 022 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Anisoptera costata0.49 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 20 n = 10

Ploidy2× diploid · measured

Chromosome records20–202n range20median20mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 203×GoaT · Kew Plant DNA C-values Database · CCDB · book-fedorov · CCDB · book-atlas-flowering-plants

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · book-fedorov — Tixier 1953

CCDB · book-atlas-flowering-plants — Tixier 1953

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=0.988 ↗

08Occurrence & distribution

Record type252 records

Wild obs. + sensor114

Museum / vouchered137

Other1

Range

Area of Occupancy AOO464 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 56≤1 km 22≤10 km 5>10 km 5

88 georeferenced · 26 without coordinates

Open the mapobservation + sensor114

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 5

5 georeferenced · 132 without coordinates

Open the institutions mapphysical evidence137

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Philadelphia, US	5
Cibinong Science Center, Herbarium Bogorienselocation not on record	3
National Institute of Biological Resourceslocation not on record	2
Edinburgh, GB	2
Pondicherry, IN	2
Paris, FR	1
Bronx, US	1
Saint Louis, US	1

8 institutions · 17 of 137 vouchered records shown · 120 without an institution code

09Environmental DNA5 detections

Where the DNA of Anisoptera costata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.6 °C 26.2–26.6

Seasonal swing summer↔winter1.30 °C

Max temp (day)30.0 °C 29.6–30.0

Min temp (night)23.0 °C 22.7–23.0

Precipitation243 mm/mo 243–264

Air humidity66.4 % 66.4–67.8

Moisture balance102 mm/mo 102–127

Vapour deficit1,173 Pa 1,098–1,173

Wind speed1.40 m/s 1.30–1.40

Cloud cover54.2 % 54.2–56.9

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)