Anisoplaca achyrota

(Meyrick, 1885) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Gelechiidae/Anisoplaca

At a glance

Occurrence records355

Data sources8

Biological traits0

DNA specimens6

eDNA detections7

Sources8 archives

Databases and archives Anisoplaca achyrota's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility355 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF355 records

Environmental DNA1 datasets · 1 countries7 detections

DNA & barcodingBOLD6 specimens

01Narrative

Anisoplaca achyrota is a species of moth in the family Gelechiidae. It was first described by Edward Meyrick in 1885 and is endemic to New Zealand. This species has been observed in both the North and South Islands and inhabits native forest. The larvae of this species feed on the green seeds of Hoheria angustifolia and as such is regarded as an indicator species for mature native forest. The adults of the species are commonly on the wing from December until February and are attracted to light.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anisoplaca achyrota has left across the world's sequence archives.

At a glance

DNA specimens6

BINs1

Marker genes1

eDNA detections7

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P669 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.48%

Haplotypes1

BIN1

Where individuals differ — all 8 variable positions, in barcode order

20Gmostly conserved

346Tmostly conserved

406Tmostly conserved

412Avariable

514Tmostly conserved

530Tmostly conserved

601Tmostly conserved

624Gmostly conserved

AACTTTATATTTTATTTTTGGAATCTGAGCTGGTATAGTAGGAACATCTTTAAGTTTATTAATTCGAGCTGAATTAGGTAATCCTGGTTC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Pexicopia proseliasame family7.0%Pexicopia arenicolasame family7.0%Pexicopia malvellasame family7.0%Pexicopia euryanthessame family7.0%Pexicopia epactaeasame family7.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type355 records

Wild obs. + sensor311

Museum / vouchered44

Range

Area of Occupancy AOO352 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 227≤1 km 41≤10 km 14>10 km 4

286 georeferenced · 25 without coordinates

Open the mapobservation + sensor311

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy41% within 1 km

≤1 km 7≤10 km 9>10 km 1

17 georeferenced · 27 without coordinates

Open the institutions mapphysical evidence44

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Auckland, NZ	18
MWLRlocation not on record	5
New Zealand Arthropod Collectionlocation not on record	4
Wellington, NZ	2

4 institutions · 29 of 44 vouchered records shown · 15 without an institution code

09Environmental DNA7 detections

Where the DNA of Anisoplaca achyrota was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.7 °C 9.90–19.2

Seasonal swing summer↔winter9.80 °C

Max temp (day)17.5 °C 13.0–22.7

Min temp (night)10.2 °C 5.90–14.5

Precipitation97.2 mm/mo 69.6–283

Air humidity61.8 % 60.1–66.2

Moisture balance-4.10 mm/mo -44.7–173

Vapour deficit590 Pa 438–882

Wind speed3.80 m/s 2.20–5.20

Cloud cover36.4 % 35.5–37.6

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)