Anisomeles malabarica

(L.) R.Br. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Lamiaceae/Anisomeles

At a glance

Occurrence records160

Data sources12

Biological traits16

DNA specimens8

eDNA detections6

Sources12 archives

Databases and archives Anisomeles malabarica's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility160 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources16 traits

Chemical compositionLOTUS · NPASS6 compounds

Occurrence & distributionGBIF160 records

Environmental DNA1 datasets · 0 countries6 detections

DNA & barcodingBOLD · NCBI8 specimens

Genome at a glanceCCDB2n = 32

01Narrative

Anisomeles malabarica, more commonly known as the Malabar catmint, is a species of herbaceous shrub in the family Lamiaceae. It is native to tropical and subtropical regions of India, and Sri Lanka, but can also be found in Malaysia, Bangladesh, Myanamar, Bismarck Archipelago, Mauritius, Andaman Is. and Réunion.Kew World Checklist of Selected Plant FamiliesKhanam, M. & Hassan, M.A. (2008). Lamiaceae. Flora of Bangladesh 58: 1-161. Bangladesh National Herbarium, Dhaka. Growing up to 2 m high, it has narrow green leaves 3–8 cm in length, and 1.5–3 cm wide. It is pollinated by sunbirds and carpenter bees, and bears purple flowers in mid spring, though it may also bear the flowers throughout the year. Originally used in Sri Lankan and Hindi folk medicine, the current main uses are medicinal, aromatics and cosmetics.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology4

Plant height1 m

Plant height max2 m

Plant height min0 m

Seed mass1.68 mg

Life cycle & reproduction3

Life formsubshrub or shrub

Life spanperennial

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Physiology & chemistry1

Nitrogen fixingnon_nitrogen_fixer

Other traits1

Plant support typefree-standing

03Chemical composition6 compounds

Compounds documented for Anisomeles malabarica across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Flavones2

Hydrocarbons1

Cembrane diterpenoids1

N-acyl amines1

Fatty alcohols $ Fatty aldehydes1

Documented compounds6 total

Tissue Source Quantified only

Compound	Amount	Source
(Z,Z,Z)-1,8,11,14-Heptadecatetraene	present	NPASS
3,12-Dimethyl-8-methylidene-6,18-dioxatricyclo[14.2.1.05,9]nonadeca-3,12,16(19)-triene-7,17-dione	present	LOTUS
[(2R,3S,4R,5R,6S)-4,5-dihydroxy-6-[5-hydroxy-2-(4-hydroxyphenyl)-4-oxochromen-7-yl]oxy-3-[(E)-3-(4-hydroxyphenyl)prop-2-enoyl]oxyoxan-2-yl]methyl (E)-3-(4-hydroxyphenyl)prop-2-enoate	present	LOTUS
Apigenin 7-O-(2'',6''-di-O-E-p-coumaroyl)glucoside	present	LOTUS
Tetradeca-2E,4E-Dienoic Acid Isobutylamide	present	NPASS
Trideca-1,11-dien-3,5,7,9-tetrayn	present	NPASS

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anisomeles malabarica has left across the world's sequence archives.

At a glance

DNA specimens8

Marker genes4

GenBank sequences8

eDNA detections6

Countries1

The DNA barcodea real sequence read deposited for this species

ITSPV731505.1 ↗334 bpIndia · 2025

ACGT

CCCCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCAAAGCAGAC …

Anisomeles malabarica voucher SCRIPCOGAM81 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, complete sequence; and 5.8S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL3★ITS3trnH-psbA

plant barcodefungal barcodemarker

06Genome at a glanceCCDB

The complete instruction manual Anisomeles malabarica carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 32 n = 16

Ploidypolyploid inferred

Chromosome records32–342n range32median32mode7records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 325×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 · CCDB · book-indian_vol1

CCDB · ipcn-api-dl — Vembu, B. & R. Sampathkumar. 1982. Karyomorphological studies in some members of Lamiaceae. J. Cytol. Genet. 17: 97–106.

CCDB · ipcn-api-dl — Thoppil, J. E. & J. Jose. 1998. Chromosome configuration and evolution of base numbers in Anisomeles R. Br. (Lamiaceae). Glimpses Pl. Res. 12(1): 173–177.

CCDB · ipcn-api-dl — Vembu, B. & R. Sampathkumar. 1978. In IOPB chromosome number reports LXII. Taxon 27: 519–535.

CCDB · book-ipcn75-78 — Vembu & Sampathkumar 1978

CCDB · book-indian_vol1 — Vembu, B. & Sampathkumar, R. 1978

2n 342×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Krishnappa, D. G. & I. Basavaraj. 1982. In IOPB chromosome number reports LXXV. Taxon 31: 361–362.

CCDB · ipcn-api-dl — Vembu, B. 1979a. Cytotaxonomical observations in two species of Anisomeles. Proc. Indian Sci. Congr. Assoc. (III, C) 66:99.

n 173×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Saggoo, M. I. & S. S. Bir. 1982. In: IOPB chromosome number reports LXXVI. Taxon 31: 593–595.

CCDB · ipcn-api-dl — Bir, S. S. & M. I. S. Saggoo. 1985. Cytological studies on members of family Labiatae from Kodaikanal and adjoining areas (South India). Proc. Indian Acad. Sci. 94: 619–626.

CCDB · ipcn-api-dl — Vembu, B. 1979a. Cytotaxonomical observations in two species of Anisomeles. Proc. Indian Sci. Congr. Assoc. (III, C) 66:99.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=0.036 ↗

08Occurrence & distribution

Record type160 records

Wild obs. + sensor29

Museum / vouchered122

Other9

Origin

Native24

Introduced1

Range

Area of Occupancy AOO560 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 4≤1 km 13≤10 km 3>10 km 1

21 georeferenced · 8 without coordinates

Open the mapobservation + sensor29

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy72% within 1 km

≤100 m 17≤1 km 38≤10 km 16>10 km 5

76 georeferenced · 46 without coordinates

Open the institutions mapphysical evidence122

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museo Entomologico de Leonlocation not on record	25
Mount Annan, AU	24
Adelaide, AU	19
Kew, GB	16
South Kensington, GB	15
John T. Waterhouse Herbariumlocation not on record	6
Baroda, IN	3
Canberra, AU	3
Hobart, AU	2
Brisbane, AU	2
LDlocation not on record	2
NGCPR01374location not on record	1
Miami, US	1
Honolulu, US	1
Palmerston, AU	1

15 institutions · 121 of 122 vouchered records shown · 1 without an institution code

09Environmental DNA6 detections

Where the DNA of Anisomeles malabarica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map0 countries0

High altitude, Semi desert plains

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)