Anisogona simana

Meyrick, 1881 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Anisogona

At a glance

Occurrence records193

Data sources7

Biological traits0

DNA specimens7

eDNA detections5

Sources7 archives

Databases and archives Anisogona simana's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility193 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF193 records

Environmental DNA1 datasets · 1 countries5 detections

DNA & barcodingBOLD7 specimens

01Narrative

Anisogona simana es una especie de polilla de la familia Tortricidae. Se encuentra en Australia.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anisogona simana has left across the world's sequence archives.

At a glance

DNA specimens7

BINs3

Marker genes2

eDNA detections5

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 27 variable positions, in barcode order

43Amostly conserved

46Tvariable

82Cmostly conserved

100Amostly conserved

106Tvariable

136Tvariable

202Cmostly conserved

205Tmostly conserved

232Cvariable

250Cvariable

286Cvariable

340Tmostly conserved

346Tvariable

358Tmostly conserved

364Cvariable

370Cvariable

400Avariable

485Cvariable

490Cmostly conserved

505Tmostly conserved

508Cvariable

616Cmostly conserved

625Avariable

628Amostly conserved

631Amostly conserved

634Cmostly conserved

646Cvariable

TACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACTTCATTAAGACTATTAATTCGAGCTGAATTAGGTAACCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.2%

Haplotypes4

BINs3

Most divergent pair3.3%

Oceania

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anisogona similanasame genus7.8%Conchylis subfurcatanasame family8.4%Meritastis ferreasame family8.4%Conchylis vacuanasame family8.8%Thrincophora lignigeranasame family9.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type193 records

Wild obs. + sensor176

Museum / vouchered17

Range

Area of Occupancy AOO248 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy97% within 1 km

≤100 m 96≤1 km 54≤10 km 2>10 km 2

154 georeferenced · 22 without coordinates

Open the mapobservation + sensor176

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 17 records without

Open the institutions mapphysical evidence17

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Australian National Fish Collectionlocation not on record	15
Australian National Insect Collectionlocation not on record	1

2 institutions · 16 of 17 vouchered records shown · 1 without an institution code

09Environmental DNA5 detections

Where the DNA of Anisogona simana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.2 °C 20.3–23.1

Seasonal swing summer↔winter6.50 °C

Max temp (day)24.5 °C 22.7–25.9

Min temp (night)18.5 °C 17.9–21.2

Precipitation130 mm/mo 26.6–324

Air humidity61.3 % 60.1–70.3

Moisture balance249 mm/mo

Vapour deficit904 Pa 779–1,099

Wind speed4.00 m/s

Cloud cover33.4 % 26.7–58.3

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)