Anisodontea capensis

(L.) D.M.Bates · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malvales/Malvaceae/Anisodontea

At a glance

Occurrence records118

Data sources8

Biological traits13

DNA specimens1

eDNA detections1

Sources8 archives

Databases and archives Anisodontea capensis's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility118 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources13 traits

Occurrence & distributionGBIF118 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Anisodontea capensis, known as African mallow, dwarf hibiscus, Cape mallow and false mallow, is a species in the tribe Malveae in the family Malvaceae that is native to South Africa.Anisodontea capensis (African Mallow) It has gained the Royal Horticultural Society's Award of Garden Merit as an ornamental.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTAusTraitsTRY

Size & morphology2

Plant height max1.21 m

Plant height min0.75 m

Life cycle & reproduction2

Life formshrub

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max2 167 m

Elevation min670 m

Epiphyteterrestrial

Growth formshrub

⚠ sources differ — GIFT: shrub · AusTraits: shrub · TRY: Forb/herb, Subshrub

Woodinesswoody

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anisodontea capensis has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences3

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSAJ251171.1 ↗227 bp

ACGT

CGTCGCCCCCATCAAACTCTGAGCCCTTGGGCTACGGTTGCACTGTGGGCGGAAATTGGCCTCCCGTGCGCTCACCGCTCGCGGTTGGCC …

Anisodontea capensis internal transcribed spacer 2 (ITS2)

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS3★ITS2

fungal barcode

08Occurrence & distribution

Record type118 records

Wild obs. + sensor42

Museum / vouchered76

Origin

Introduced38

Range

Area of Occupancy AOO224 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 11≤1 km 31

42 georeferenced

Open the mapobservation + sensor42

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy57% within 1 km

≤100 m 11≤1 km 13≤10 km 17>10 km 1

42 georeferenced · 34 without coordinates

Open the institutions mapphysical evidence76

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museo Entomologico de Leonlocation not on record	21
Pretoria, ZA	10
Durban, ZA	7
SLU Artdatabankenlocation not on record	7
LDlocation not on record	6
Auckland, NZ	5
Hobart, AU	4
Canadian Department of Agriculturelocation not on record	2
Mlocation not on record	1
Claremont, US	1
Riverside, US	1
Cape Town, ZA	1
Saint Louis, US	1
Adelaide, AU	1
San Diego, US	1
Valdosta State Universitylocation not on record	1
Christchurch, NZ	1
South Kensington, GB	1
Helsinki, FI	1

19 institutions · 73 of 76 vouchered records shown · 3 without an institution code

09Environmental DNA1 detections

Where the DNA of Anisodontea capensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)