Anisakis simplex

(Rudolphi, 1809) Dujardin, 1845 · species

image placeholder — illustration coming later

Animalia/Nematoda/Chromadorea/Rhabditida/Anisakidae/Anisakis

At a glance

Occurrence records245

Data sources10

Biological traits0

DNA specimens83

eDNA detections33

Sources10 archives

Databases and archives Anisakis simplex's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility218 records↗

OBISOcean Biodiversity Information System27 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI33 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics83 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF · OBIS245 records

Environmental DNA1 datasets · 4 countries33 detections

DNA & barcodingBOLD83 specimens

Genome at a glanceGoaT · NCBI≈168 Mbp

01Narrative

Anisakis simplex est une espèce de nématodes parasites des phoques et de la chaîne alimentaire en dessous, allant jusqu'aux petits crustacés (Mysidae). L'humain infesté par l'ingestion d'Anisakis simplex vivant peut développer une anisakiase. On l'appelle aussi "ver de hareng". Plusieurs cas d'infection humaine ont été causés par l'ingestion de hareng mariné, la cuisson étant presque le seul moyen de supprimer le danger des larves.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding83 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anisakis simplex has left across the world's sequence archives.

At a glance

DNA specimens83

BINs3

Marker genes12

eDNA detections33

Countries12

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P619 bp consensus47 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Where individuals differ — all 37 variable positions, in barcode order

72Tmostly conserved

126Cvariable

138Tvariable

144Tvariable

153Gvariable

188Tmostly conserved

219Gvariable

222Gvariable

243Tvariable

282Tmostly conserved

285Amostly conserved

288Tvariable

315Gvariable

333Tvariable

337Tvariable

352Tvariable

357Cvariable

358Tmostly conserved

375Tvariable

379Tvariable

381Gvariable

387Tmostly conserved

393Tvariable

444Tmostly conserved

447Gvariable

450Tvariable

462Avariable

528Gvariable

529Tvariable

534Gvariable

537Tmostly conserved

546Cvariable

579Tmostly conserved

582Gvariable

585Tmostly conserved

600Gvariable

612Gvariable

GCTCTTTCTTTAATTATTCGTCTTGAGTTGGCTAAGCCGGGTCTTTTTTTGGGTAATGGGCAGTTGTATAATTCTGTTATTACTGCTCAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.0%

Haplotypes24

BINs3

Most divergent pair5.5%

OceaniaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anisakis typicasame genus1.7%Pseudoterranova krabbeisame family10.1%Toxascaris leoninasame order10.6%Toxocara catisame order10.9%Pseudoterranova decipienssame family11.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5PCOIICOXIIICYTBND1ND2ND3ND4ND4LND5-0ND6

animal barcodemitochondrial

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_007934 ↗ · 12 protein · 22 tRNA · 2 rRNA

ND1ATP6ND2CYTBCOX3ND4COX1COX2ND3ND5ND6ND4Ll-rRNAs-rRNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT · NCBI

The complete instruction manual Anisakis simplex carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈167 658 184 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

THIS GENOME Anisakis simplex0.17 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

Completeness71.3% BUSCO

08Occurrence & distribution

Record type245 records

Wild obs. + sensor33

Museum / vouchered210

Other2

Range

Area of Occupancy AOO424 km²

Depth

0–200 m sunlit1

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 31.1 m · max 31.1 m · 1 record with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy55% within 1 km

≤100 m 5≤1 km 1≤10 km 2>10 km 3

11 georeferenced · 22 without coordinates

Open the mapobservation + sensor33

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 4>10 km 2

6 georeferenced · 204 without coordinates

Open the institutions mapphysical evidence210

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	51
Maurice Lamontagne Institutelocation not on record	15
Santa Barbara Museum of Natural Historylocation not on record	4
Saint John, CA	1
Edmonton, CA	1
NHMOlocation not on record	1

6 institutions · 73 of 210 vouchered records shown · 93 without an institution code

09Environmental DNA33 detections

Where the DNA of Anisakis simplex was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found33

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 33 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.6 °C 9.70–22.0

Seasonal swing summer↔winter25.8 °C

Max temp (day)16.4 °C 14.7–27.6

Min temp (night)7.40 °C 3.90–14.2

Precipitation108 mm/mo 0.2–112

Air humidity58.0 % 44.0–59.3

Moisture balance21.7 mm/mo -182–35.4

Vapour deficit690 Pa 605–1,628

Wind speed2.90 m/s 2.80–4.70

Cloud cover41.1 % 14.2–43.3

CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)