Anisacanthus quadrifidus

(Vahl) Standl. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Acanthaceae/Anisacanthus

At a glance

Occurrence records686

Data sources11

Biological traits12

DNA specimens4

eDNA detections2

Sources11 archives

Databases and archives Anisacanthus quadrifidus's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility686 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources12 traits

Chemical compositionLOTUS6 compounds

Occurrence & distributionGBIF686 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI4 specimens

Genome at a glanceCCDB2n = 36

01Narrative

Anisacanthus quadrifidus is a species of flowering plant native to west and south-central Texas in the United States and adjacent northern Mexico down through the state of Oaxaca. It is an increasingly common ornamental shrub in Texas and is cultivated in other parts of the Southwestern United States.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass11.08 mg

Seed mass max11.08 mg

Seed mass min11.08 mg

Life cycle & reproduction2

Life formshrub

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Growth formshrub

Woodinesswoody

03Chemical composition6 compounds

Compounds documented for Anisacanthus quadrifidus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile4 classes

Stigmastane steroids2

Furofuranoid lignans2

Flavones1

Lupane triterpenoids1

Documented compounds6 total

Tissue Source Quantified only

Compound	Amount	Source
(2S,3S,4S,5R,6R)-2-[4-[(3S,3aR,6S,6aR)-3-(3,4-dimethoxyphenyl)-1,3,3a,4,6,6a-hexahydrofuro[3,4-c]furan-6-yl]-2-methoxyphenoxy]-6-(hydroxymethyl)oxane-3,4,5-triol	present	LOTUS
beta-Sitosterol	present	LOTUS
Betulin	present	LOTUS
Luteolin 7-diglucoside	present	LOTUS
Phillyrin	present	LOTUS
Sitogluside	present	LOTUS

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anisacanthus quadrifidus has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes5

GenBank sequences5

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSOL537299.1 ↗254 bpUSA · 2019

ACGT

TGCAGAATCCCGTGTACCATCGAGTCTTTGAACGCAAGTTGAGCCCGAAGCCTTCGGGCCGAGGGCACGCCTTCCTAGGCATCATGCATC …

Anisacanthus quadrifidus voucher BRIT:Gostel495 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL2★ITS2★ITS2trnH-psbA

plant barcodefungal barcodemarker

06Genome at a glanceCCDB

The complete instruction manual Anisacanthus quadrifidus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 36 n = 18

Ploidypolyploid inferred

Chromosome records36–362n range36median36mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 362×CCDB · book-fedorov · CCDB · Cave1956

CCDB · book-fedorov — Grant W. F. 1955

CCDB · Cave1956 — Grant

n 184×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Daniel, T. F. & T. I. Chuang. 1993. Chromosome numbers of New World Acanthaceae. Syst. Bot. 18: 283–289.

CCDB · ipcn-api-dl — Daniel, T. F., T. I. Chuang & M. A. Baker. 1990. Chromosome numbers of American Acanthaceae. Syst. Bot. 15(1): 13–25.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type686 records

Wild obs. + sensor648

Museum / vouchered38

Range

Area of Occupancy AOO1 456 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 474≤1 km 43≤10 km 16>10 km 37

570 georeferenced · 78 without coordinates

Open the mapobservation + sensor648

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 3>10 km 1

4 georeferenced · 34 without coordinates

Open the institutions mapphysical evidence38

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Ann Arbor, US	13
Austin, US	12
Riverside, US	5
Phoenix, US	1
Henderson, US	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1
Smithsonian Institution, National Museum of Natural Historylocation not on record	1
Universität Göttingenlocation not on record	1
ASUlocation not on record	1

9 institutions · 36 of 38 vouchered records shown · 2 without an institution code

09Environmental DNA2 detections

Where the DNA of Anisacanthus quadrifidus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median29.2 °C 29.2–29.2

Seasonal swing summer↔winter21.6 °C

Max temp (day)34.4 °C

Min temp (night)24.7 °C

Precipitation56.3 mm/mo

Air humidity53.7 %

Moisture balance-139 mm/mo

Vapour deficit1,882 Pa

Wind speed2.90 m/s

Cloud cover25.5 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)