Anilocra chromis

Bunkley-Williams & Williams, 1981 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Malacostraca/Isopoda/Cymothoidae/Anilocra

At a glance

Occurrence records65

Data sources8

Biological traits2

DNA specimens8

eDNA detections8

Sources8 archives

Databases and archives Anilocra chromis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility55 records↗

OBISOcean Biodiversity Information System10 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF · OBIS65 records

Environmental DNA1 datasets · 0 countries8 detections

DNA & barcodingBOLD8 specimens

01Narrative

Anilocra chromis is een pissebed uit de familie Cymothoidae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1981 door Williams & Williams.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonehost

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anilocra chromis has left across the world's sequence archives.

At a glance

DNA specimens8

BINs1

Marker genes1

eDNA detections8

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P625 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 21 variable positions, in barcode order

1Amostly conserved

2Gmostly conserved

6Tmostly conserved

8Gmostly conserved

13Gmostly conserved

58Gmostly conserved

76Cmostly conserved

151Gmostly conserved

163Tmostly conserved

205Tmostly conserved

355Cmostly conserved

371Cmostly conserved

379Amostly conserved

406Cmostly conserved

412Cmostly conserved

499Tmostly conserved

553Amostly conserved

562Gmostly conserved

595Amostly conserved

622Tmostly conserved

625Gmostly conserved

AGGTGTTGTAGGGGTAGCATTTAGAATATTGATTCGTGCAGAACTTTCACAACCAGGGAATCTTTTAGGAAGAGACCAACTTTATAATGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.90%

Haplotypes7

BIN1

Most divergent pair1.9%

Other

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anilocra haemulisame genus7.2%Anilocra brillaesame genus7.4%Anilocra clupeisame genus11.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type65 records

Wild obs. + sensor15

Museum / vouchered50

Range

Area of Occupancy AOO80 km²

Depth

0–200 m sunlit5

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 3 m · max 9 m · 5 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 4≤1 km 10≤10 km 1

15 georeferenced

Open the mapobservation + sensor15

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy75% within 1 km

≤100 m 2≤1 km 1>10 km 1

4 georeferenced · 46 without coordinates

Open the institutions mapphysical evidence50

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	36
UM-RSMASlocation not on record	3
Cambridge, US	1

3 institutions · 40 of 50 vouchered records shown

09Environmental DNA8 detections

Where the DNA of Anilocra chromis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)