Anigraea deleta

(Hampson, 1891) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Euteliidae/Anigraea

At a glance

Occurrence records2

Data sources6

Biological traits0

DNA specimens8

eDNA detections4

Sources6 archives

Databases and archives Anigraea deleta's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD8 specimens

01Narrative

Anigraea deleta is een vlinder uit de familie van de Euteliidae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1891 door Hampson.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anigraea deleta has left across the world's sequence archives.

At a glance

DNA specimens8

BINs2

Marker genes1

eDNA detections4

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 90% of positions are identical in every specimen.

Where individuals differ — all 65 variable positions, in barcode order

4Amostly conserved

22Amostly conserved

46Amostly conserved

55Tmostly conserved

59Cmostly conserved

85Amostly conserved

91Tmostly conserved

100Amostly conserved

103Cvariable

124Cmostly conserved

166Gmostly conserved

197Cmostly conserved

199Tmostly conserved

217Amostly conserved

220Tmostly conserved

223Tmostly conserved

241Tmostly conserved

263Tmostly conserved

265Amostly conserved

271Tmostly conserved

283Amostly conserved

284Tmostly conserved

322Tmostly conserved

325Amostly conserved

337Tmostly conserved

340Tmostly conserved

343Amostly conserved

346Tmostly conserved

352Tmostly conserved

379Amostly conserved

386Tmostly conserved

388Amostly conserved

391Tmostly conserved

397Tmostly conserved

400Amostly conserved

406Tmostly conserved

412Amostly conserved

421Amostly conserved

433Tmostly conserved

436Tmostly conserved

442Cmostly conserved

460Cmostly conserved

469Amostly conserved

470Cmostly conserved

479Amostly conserved

508Amostly conserved

517Tmostly conserved

520Tmostly conserved

526Amostly conserved

532Tmostly conserved

539Tmostly conserved

542Cmostly conserved

544Tmostly conserved

547Amostly conserved

562Amostly conserved

565Tmostly conserved

574Amostly conserved

577Gmostly conserved

586Tmostly conserved

607Tmostly conserved

619Tmostly conserved

631Amostly conserved

637Amostly conserved

641Tmostly conserved

643Amostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACATCTTTAAGTTTACTAATTCGAGCAGAATTAGGAAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.4%

Haplotypes3

BINs2

Most divergent pair9.9%

Asia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anigraea mediopunctatasame genus5.8%Anigraea cinctipalpissame genus7.1%Penicillaria ethiopicasame family7.3%Neohipparchus vallatasame order7.4%Parasynegia sundastriariasame order7.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type2 records

Museum / vouchered2

Range

Area of Occupancy AOO8 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the institutions mapphysical evidence2

10Collections & institutions

Holding institutions1 of 1 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	1

1 institutions · 1 of 2 vouchered records shown · 1 without an institution code

09Environmental DNA4 detections

Where the DNA of Anigraea deleta was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.0 °C 25.0–25.0

Seasonal swing summer↔winter1.20 °C

Max temp (day)28.6 °C

Min temp (night)21.2 °C

Precipitation214 mm/mo

Air humidity67.3 %

Moisture balance76.0 mm/mo

Vapour deficit1,034 Pa

Wind speed1.40 m/s

Cloud cover67.3 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)