Anigozanthos manglesii

D.Don · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Commelinales/Haemodoraceae/Anigozanthos

At a glance

Occurrence records1 092

Data sources9

Biological traits29

DNA specimens3

eDNA detections3

Sources9 archives

Databases and archives Anigozanthos manglesii's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 092 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources29 traits

Occurrence & distributionGBIF1 092 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 12

01Narrative

Anigozanthos manglesii ou "patte de Mangles" est une espèce de la famille des Haemodoraceae. C'est une « patte de kangourou ». Cette plante fait partie du genre Anigozanthos. Ce nom lui vient du grec ‘’anisos’’ qui signifie ‘inégal’ et “anthos” qui signifie fleur. Cette signification fait référence aux sous-divisions de la fleur en 6 parties inégales de l’inflorescence. Son nom spécifique “manglesii” est dû à Robert Mangles qui a été le premier à élever une graine de cette espèce dans son jardin en Angleterre. A. manglesii est une espèce végétale endémique de l'Australie occidentale, et l'emblème floral de l'État.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology10

Leaf length250 mm

Leaf mass per area81.57 g/m2

Leaf width8.5 mm

Plant height1.1 m

Plant height max1.1 m

Plant height min0.2 m

Seed length1.25 mm

Seed mass1.1 mg

⚠ sources differ — TRY: 1.1 mg · AusTraits: 0.7 mg · GIFT: 0.98 mg

Seed mass max1.5 mg

Seed mass min0.68 mg

Life cycle & reproduction6

Flowering timennnnnnnyyyyn

Life formperennial

Life spanperennial

Raunkiær life formhemicryptophyte

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formherb

Leaf compoundnesssimple

Leaf shapelinear

Woodinessnon-woody

Physiology & chemistry1

Nitrogen fixingnon_nitrogen_fixer

Other traits1

Plant support typefree-standing

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anigozanthos manglesii has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes2

GenBank sequences4

eDNA detections3

The DNA barcodea real sequence read deposited for this species

rbcLAM110248.1 ↗1 306 bp

ACGT

TACAAATTGACTTATTATACTCCTGAGTATGAAACCAAGGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCG …

Anigozanthos manglesii plastid partial rbcL gene for ribulose bisphosphate carboxylase large subunit, specimen voucher Asmussen 109 (CP)

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL3

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Anigozanthos manglesii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 12 n = 6

Ploidydiploid inferred

Chromosome records12–122n range12median12mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 122×CCDB · book-fedorov · CCDB · kew

CCDB · book-fedorov — Green J. W. 1961

CCDB · kew — Šmarda P, Bureš P, Horová L, Leitch IJ, Mucina L, Pacini E, Tichý L, Grulich V, Rotreklová O. 2014. Ecological and evolutionary significance of genomic GC content diversity in monocots. Proceedings of the National Academy of Sciences 111: E4096-E4102.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=0.999 ↗

08Occurrence & distribution

Record type1 092 records

Wild obs. + sensor963

Museum / vouchered128

Cultivated / captive1

Origin

Native33

Range

Area of Occupancy AOO1 972 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 510≤1 km 147≤10 km 57>10 km 48

762 georeferenced · 201 without coordinates

Open the mapobservation + sensor963

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy16% within 1 km

≤100 m 10≤1 km 6≤10 km 74>10 km 7

97 georeferenced · 31 without coordinates

Open the institutions mapphysical evidence128

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 21 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kensington, AU	44
Adelaide, AU	20
Mount Annan, AU	18
Museo Entomologico de Leonlocation not on record	7
Brisbane, AU	5
Kew, GB	4
GHPG$location not on record	3
Wellington, NZ	3
Auckland, NZ	3
Armidale, AU	3
BGPAlocation not on record	3
Claremont, US	2
University of Alberta Museumslocation not on record	2
Canberra, AU	2
Smithfield, AU	2
Boise, US	1
Phoenix, US	1
US	1
China Agricultural Universitylocation not on record	1
Burlington, US	1
LDlocation not on record	1

21 institutions · 127 of 128 vouchered records shown · 1 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA3 detections

Where the DNA of Anigozanthos manglesii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anigozanthos manglesii

At a glance

Sources9 archives

Size & morphology10

Life cycle & reproduction6

Diet & foraging1

Habitat & environment10

Physiology & chemistry1

Other traits1

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 092 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions15 of 21 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Record type1 092 records