Anigozanthos flavidus

Redouté · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Commelinales/Haemodoraceae/Anigozanthos

At a glance

Occurrence records676

Data sources9

Biological traits36

DNA specimens7

eDNA detections6

Sources9 archives

Databases and archives Anigozanthos flavidus's data was compiled from.

GBIFGlobal Biodiversity Information Facility676 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements4 literature sources36 traits

Occurrence & distributionGBIF676 records

Environmental DNA1 datasets · 1 countries6 detections

DNA & barcodingBOLD · NCBI7 specimens

Genome at a glanceCCDB · GoaT1.5 Gbp

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology14

Leaf length455 mm

Leaf length max1 000 mm

Leaf length min350 mm

Leaf width7.5 mm

Leaf width max20 mm

Leaf width min5 mm

Plant height3 m

Plant height max3 m

Plant height min0.5 m

Seed length2 mm

Seed mass0.692 mg

⚠ sources differ — TRY: 0.692 mg · AusTraits: 0.639 mg · GIFT: 0.69 mg

Seed mass max0.69 mg

Seed mass min0.69 mg

Seed width1.06 mm

Life cycle & reproduction9

Flowering endJan

Flowering startNov

Flowering timeynnnnnnnnnyy

Life formperennial

Life spanperennial

Pollination syndromebird+insect

Raunkiær life formhemicryptophyte

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment11

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation mean2 600 m

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formherb

Leaf compoundnesssimple

Leaf shapelinear

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anigozanthos flavidus has left across the world's sequence archives.

At a glance

DNA specimens7

Marker genes3

GenBank sequences8

eDNA detections6

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLEF422992.1 ↗1 159 bp

ACGT

GGATTTAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGAGTATGAAACCAAGGATACTGATATCTTGGCAGCATTCCGA …

Anigozanthos flavidus ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; plastid

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL6★rbcLa

plant barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Anigozanthos flavidus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size1 508 415 306 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Anigozanthos flavidus1.51 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 12 n = 6

Ploidy2× diploid · measured

Chromosome records12–122n range12median12mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 124×GoaT · Kew Plant DNA C-values Database · CCDB · book-fedorov · CCDB · kew

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · book-fedorov — Stenar 1927a

CCDB · book-fedorov — Green J. W. 1961

CCDB · kew — Šmarda P, Bureš P, Horová L, Leitch IJ, Mucina L, Pacini E, Tichý L, Grulich V, Rotreklová O. 2014. Ecological and evolutionary significance of genomic GC content diversity in monocots. Proceedings of the National Academy of Sciences 111: E4096-E4102.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

diploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=0.999 ↗

08Occurrence & distribution

Record type676 records

Wild obs. + sensor404

Museum / vouchered265

Cultivated / captive7

Origin

Native23

Introduced28

Range

Area of Occupancy AOO1 512 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 211≤1 km 70≤10 km 18>10 km 26

325 georeferenced · 79 without coordinates

Open the mapobservation + sensor404

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤100 m 52≤1 km 24≤10 km 123>10 km 28

227 georeferenced · 38 without coordinates

Open the institutions mapphysical evidence265

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy20% within 1 km

≤100 m 1≤10 km 4

5 georeferenced · 2 without coordinates

Open the mapnot free-living7

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kensington, AU	115
Museo Entomologico de Leonlocation not on record	43
Mount Annan, AU	33
Canberra, AU	25
Adelaide, AU	18
Hobart, AU	10
Brisbane, AU	7
BGPAlocation not on record	4
Kew, GB	3
Joondalup, AU	2
EL PASO, US	1
Bronx, US	1
South African National Biodiversity Institute, Compton Herbariumlocation not on record	1
John T. Waterhouse Herbariumlocation not on record	1
Armidale, AU	1

15 institutions · 265 of 265 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA6 detections

Where the DNA of Anigozanthos flavidus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.2 °C 16.2–16.2

Seasonal swing summer↔winter7.90 °C

Max temp (day)19.1 °C

Min temp (night)13.2 °C

Precipitation55.3 mm/mo

Air humidity62.0 %

Moisture balance-102 mm/mo

Vapour deficit700 Pa

Wind speed6.50 m/s

Cloud cover12.3 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)