Anidorus nigrinus

(Germar, 1842) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Aderidae/Anidorus

At a glance

Occurrence records2 046

Data sources7

Biological traits0

DNA specimens23

eDNA detections135

Sources7 archives

Databases and archives Anidorus nigrinus's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 046 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI135 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics23 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 046 records

Environmental DNA4 datasets · 7 countries135 detections

DNA & barcodingBOLD23 specimens

01Narrative

Anidorus nigrinus, auch als Gemeiner Baummulmkäfer bekannt, ist ein Käfer aus der Familie der Baummulmkäfer (Aderidae). In Mitteleuropa ist Anidorus nigrinus die häufigste von insgesamt neun dort vorkommenden Arten der Familie.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding23 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anidorus nigrinus has left across the world's sequence archives.

At a glance

DNA specimens23

BINs1

Marker genes1

eDNA detections135

Countries7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus23 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.06%

Haplotypes2

BIN1

Most divergent pair0.15%

AACTTTATATTTAATCTTTGGTGCTTGATCAGGCATATTAGGAACTTCTTTAAGACTTTTAATTCGCTCAGAATTAGGAAACCCCGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Euglenes pygmaeussame family12.5%Opisthoxia formosantesame order14.3%Stigmella tatricasame order14.3%Gangara thyrsissame order14.4%Eublemma loxotomasame order14.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type2 046 records

Wild obs. + sensor1 301

Museum / vouchered623

Cultivated / captive1

Other121

Origin

Native134

Range

Area of Occupancy AOO3 880 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy68% within 1 km

≤100 m 628≤1 km 155≤10 km 359>10 km 13

1 155 georeferenced · 146 without coordinates

Open the mapobservation + sensor1 301

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy58% within 1 km

≤100 m 157≤1 km 158≤10 km 227>10 km 2

544 georeferenced · 79 without coordinates

Open the institutions mapphysical evidence623

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 31 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
SLU Artdatabankenlocation not on record	118
IFR-DNFlocation not on record	60
Metsähallituslocation not on record	52
Zürich, CH	18
Bern, CH	17
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	16
Muzeum Górnośląskie w Bytomiulocation not on record	15
Tallinn, EE	12
Geneva, CH	12
ZSMlocation not on record	10
Trondheim, NO	10
Tartu, EE	9
NMOKlocation not on record	7
Naturéum — Muséum cantonal des sciences naturelles, Lausanne, Département Zoologielocation not on record	7
BioFokuslocation not on record	6
Adam Mickiewicz University in Poznańlocation not on record	6
Dhaka, BD	6
neflocation not on record	6
Helsinki, FI	5
NHMOlocation not on record	5
LSMlocation not on record	5
Olocation not on record	4
NTNU-VMlocation not on record	4
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	4
MZLUlocation not on record	3
Paro, BT	2
Fribourg, CH	2
Nijmegen, NL	2
Musee d'Histoire Naturallelocation not on record	2
NMBU:MINAlocation not on record	1
Tilburg, NL	1

31 institutions · 427 of 623 vouchered records shown · 196 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA135 detections

Where the DNA of Anidorus nigrinus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found135

Studies independent surveys4

Countries7

Verifiable raw sequence linked98

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 135 detections have coordinates

Open the map7 countries0

HalbtrockenrasenFichtenstÃ¤mmeehem. Sandgrubevon Totholz und aus der Vegetation geklopftHofgelÃ¤ndeForest edge (suburban)

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.6 °C 13.4–17.2

Seasonal swing summer↔winter18.5 °C

Max temp (day)18.8 °C 16.5–21.4

Min temp (night)10.7 °C 9.20–13.6

Precipitation70.3 mm/mo 57.3–90.8

Air humidity59.3 % 57.3–61.4

Moisture balance-48.0 mm/mo -63.6–-17.2

Vapour deficit693 Pa 602–810

Wind speed3.20 m/s 2.50–4.20

Cloud cover43.5 % 38.6–52.8

CHELSA 1981–2010, ~9 km grid, at location & month of 134 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anidorus nigrinus

At a glance

Sources7 archives

At a glance

Record type2 046 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions12 of 31 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 046 records