Aniculus retipes

Lewinsohn, 1982 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Malacostraca/Decapoda/Diogenidae/Aniculus

At a glance

Occurrence records175

Data sources5

Biological traits4

DNA specimens12

eDNA detections11

Sources5 archives

Databases and archives Aniculus retipes's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility110 records↗

OBISOcean Biodiversity Information System65 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI11 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF · OBIS175 records

Environmental DNA1 datasets · 2 countries11 detections

DNA & barcodingBOLD12 specimens

01Narrative

Aniculus retipes is een tienpotigensoort uit de familie van de Diogenidae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1982 door Lewinsohn.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonereef-associated

Other traits2

Depth max20 m

Depth min0 m

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aniculus retipes has left across the world's sequence archives.

At a glance

DNA specimens12

BINs1

Marker genes1

eDNA detections11

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus12 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 71% of positions are identical in every specimen.

Where individuals differ — all 191 variable positions, in barcode order

2Amostly conserved

3Cmostly conserved

4Tmostly conserved

6Tmostly conserved

7Amostly conserved

9Amostly conserved

11Tmostly conserved

13Tmostly conserved

14Amostly conserved

17Tmostly conserved

18Tmostly conserved

19Tmostly conserved

21Gmostly conserved

22Amostly conserved

23Gmostly conserved

24Cmostly conserved

25Tmostly conserved

27Gmostly conserved

29Tmostly conserved

30Cmostly conserved

31Amostly conserved

32Gmostly conserved

33Gmostly conserved

34Tmostly conserved

35Amostly conserved

37Amostly conserved

39Tmostly conserved

40Amostly conserved

41Gmostly conserved

42Gmostly conserved

43Amostly conserved

44Amostly conserved

46Tmostly conserved

47Tmostly conserved

48Cmostly conserved

49Tmostly conserved

50Cmostly conserved

51Tmostly conserved

52Amostly conserved

53Amostly conserved

54Gmostly conserved

55Tmostly conserved

56Tmostly conserved

58Amostly conserved

61Cmostly conserved

62Amostly conserved

63Tmostly conserved

64Tmostly conserved

65Cmostly conserved

66Gmostly conserved

67Amostly conserved

69Cmostly conserved

70Amostly conserved

71Gmostly conserved

72Amostly conserved

74Tmostly conserved

75Tmostly conserved

76Amostly conserved

77Gmostly conserved

78Gmostly conserved

79Tmostly conserved

81Amostly conserved

83Cmostly conserved

84Cmostly conserved

85Amostly conserved

86Gmostly conserved

88Tmostly conserved

89Amostly conserved

90Gmostly conserved

91Cmostly conserved

92Cmostly conserved

94Amostly conserved

95Amostly conserved

96Tmostly conserved

97Tmostly conserved

99Gmostly conserved

100Cmostly conserved

101Gmostly conserved

103Tmostly conserved

106Tmostly conserved

115Cmostly conserved

121Amostly conserved

124Tmostly conserved

127Tmostly conserved

133Tmostly conserved

136Tmostly conserved

139Cmostly conserved

145Cmostly conserved

157Tmostly conserved

163Amostly conserved

169Amostly conserved

199Tmostly conserved

202Tmostly conserved

205Amostly conserved

217Tmostly conserved

220Amostly conserved

229Gmostly conserved

232Amostly conserved

235Tmostly conserved

241Amostly conserved

247Tmostly conserved

263Tmostly conserved

265Amostly conserved

266Tmostly conserved

274Tmostly conserved

277Tmostly conserved

278Cmostly conserved

280Amostly conserved

283Amostly conserved

286Cmostly conserved

287Tmostly conserved

289Amostly conserved

290Cmostly conserved

292Cmostly conserved

295Gmostly conserved

298Tmostly conserved

310Gmostly conserved

316Cmostly conserved

325Cmostly conserved

334Cmostly conserved

+71 more variable positions not shown

TACTTTATATTTTATTTTTGGAGCTTGATCAGGTATAGTAGGAACTTCTCTAAGTTTAATCATTCGAGCAGAATTAGGTCAACCAGGTAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)5.3%

Haplotypes4

BIN1

Most divergent pair19.0%

OtherAsiaOceania

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Eumunida sternomaculatasame order14.6%Eumunida funambulussame order15.5%Charybdis orientalissame order16.4%Bresedium brevipessame order16.7%Sesarmops impressussame order16.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type175 records

Wild obs. + sensor39

Museum / vouchered136

Range

Area of Occupancy AOO336 km²

Depth

0–200 m sunlit2

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 2.5 m · max 2.5 m · 2 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy70% within 1 km

≤100 m 11≤1 km 12≤10 km 2>10 km 8

33 georeferenced · 6 without coordinates

Open the mapobservation + sensor39

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy92% within 1 km

≤100 m 4≤1 km 8≤10 km 1

13 georeferenced · 123 without coordinates

Open the institutions mapphysical evidence136

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	46
Paris, FR	10
University of Floridalocation not on record	6
Western Australian Museumlocation not on record	5
Natick, US	4
Washington, US	2
Frankfurt am Main	1
Sydney, AU	1

8 institutions · 75 of 136 vouchered records shown

09Environmental DNA11 detections

Where the DNA of Aniculus retipes was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found11

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 11 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.7 °C 23.2–25.0

Seasonal swing summer↔winter2.20 °C

Max temp (day)25.6 °C 23.7–26.2

Min temp (night)23.7 °C 22.6–24.4

Precipitation97.5 mm/mo 89.0–112

Air humidity60.6 % 59.8–65.6

Vapour deficit1,223 Pa 969–1,265

Cloud cover13.8 % 13.6–42.9

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)