Anicla infecta

Ochsenheimer, 1816 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Anicla

At a glance

Occurrence records9 574

Data sources7

Biological traits0

DNA specimens121

eDNA detections138

Sources7 archives

Databases and archives Anicla infecta's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility9 574 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI138 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics121 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF9 574 records

Environmental DNA1 datasets · 12 countries138 detections

DNA & barcodingBOLD121 specimens

01Narrative

Anicla infecta is a moth of the family Noctuidae, described by Ochsenheimer in 1816. It is known as the green cutworm when a caterpillar and the green cutworm moth when mature. It is found from south-eastern Canada (Nova Scotia and Quebec) through the eastern United States and until Uruguay. The wingspan is 30–35 mm. Adults are on wing from June to September depending on the location. The larvae feed on beets, grasses and tobacco. Adults are a pollinator of fetterbush lyonia.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding121 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anicla infecta has left across the world's sequence archives.

At a glance

DNA specimens121

BINs3

Marker genes1

eDNA detections138

Countries12

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus120 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 13 variable positions, in barcode order

70Tmostly conserved

205Tmostly conserved

220Amostly conserved

278Tmostly conserved

340Tmostly conserved

367Tmostly conserved

382Tmostly conserved

397Tmostly conserved

401Tmostly conserved

562Tmostly conserved

616Tmostly conserved

641Cmostly conserved

646Cmostly conserved

AACATTATATTTTATTTTTGGTATTTGAGCTGGTATAGTAGGAACATCATTAAGATTATTAATTCGAGCTGAATTAGGAAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.70%

Haplotypes9

BINs3

Most divergent pair2.0%

N.AmericaS.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anicla cemoliasame genus3.6%Anicla lubricanssame genus3.8%Anicla sullivanisame genus4.1%Protogygia polingisame family4.3%Actebia fennicasame family4.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type9 574 records

Wild obs. + sensor8 820

Museum / vouchered754

Range

Area of Occupancy AOO14 316 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 4 708≤1 km 1 075≤10 km 302>10 km 1 063

7 148 georeferenced · 1 672 without coordinates

Open the mapobservation + sensor8 820

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy19% within 1 km

≤100 m 14≤1 km 64≤10 km 236>10 km 89

403 georeferenced · 351 without coordinates

Open the institutions mapphysical evidence754

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
National Biodiversity Institute, Costa Ricalocation not on record	156
New Haven, US	132
King Saud Universitylocation not on record	79
Georgia Museum of Natural Historylocation not on record	76
CUlocation not on record	48
East Lansing, US	46
ASUlocation not on record	44
Mississippi State, US	27
PUC-RSlocation not on record	26
St. Paul, US	19
The University of the West Indies, Trinidad and Tobagolocation not on record	16
Cleveland Museum of Natural History, OH (CLEV)location not on record	12
Brussels, BE	10
RBINS-Scientific Heritagelocation not on record	7
Ciudad de México, MX	6
University of Pennsylvanialocation not on record	2
ZSMlocation not on record	2
UDlocation not on record	2
OSUClocation not on record	1
Philadelphia, US	1
Area de Conservacion Guanacastelocation not on record	1
Albuquerque, US	1
San Diego, US	1

23 institutions · 715 of 754 vouchered records shown · 39 without an institution code

09Environmental DNA138 detections

Where the DNA of Anicla infecta was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found138

Studies independent surveys1

Countries12

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 138 detections have coordinates

Open the map12 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.3 °C 19.4–26.2

Seasonal swing summer↔winter2.40 °C

Max temp (day)27.2 °C 23.6–30.6

Min temp (night)21.4 °C 15.4–24.0

Precipitation183 mm/mo 53.5–371

Air humidity66.2 % 58.1–71.3

Moisture balance12.5 mm/mo -97.3–220

Vapour deficit953 Pa 728–1,294

Wind speed3.30 m/s 1.20–5.50

Cloud cover34.2 % 15.2–46.0

CHELSA 1981–2010, ~9 km grid, at location & month of 136 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anicla infecta

At a glance

Sources7 archives

At a glance

Record type9 574 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions9 of 23 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type9 574 records