Anicla illapsa

Walker, 1857 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Anicla

At a glance

Occurrence records612

Data sources5

Biological traits0

DNA specimens32

eDNA detections36

Sources5 archives

Databases and archives Anicla illapsa's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility612 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI36 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics32 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF612 records

Environmental DNA1 datasets · 2 countries36 detections

DNA & barcodingBOLD32 specimens

01Narrative

Anicla illapsa (snowy dart) is a moth of the family Noctuidae. It is found from New Brunswick to Florida, west to Texas, Nebraska and Ontario. The wingspan is 29–35 mm. Adults are on wing from May to October. There are two generations per year. Larvae have been reared on Phleum pratense and probably feed on various other grasses in the wild.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding32 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anicla illapsa has left across the world's sequence archives.

At a glance

DNA specimens32

BINs1

Marker genes1

eDNA detections36

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus31 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 10 variable positions, in barcode order

59Cmostly conserved

226Tmostly conserved

268Cmostly conserved

313Cmostly conserved

442Cmostly conserved

479Cmostly conserved

565Cmostly conserved

628Amostly conserved

634Cmostly conserved

646Tmostly conserved

AACATTATATTTTATTTTTGGTATTTGAGCTGGTATAGTAGGAACATCTTTAAGTTTACTAATTCGAGCTGAATTAGGAAATCCAGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.41%

Haplotypes11

BIN1

Most divergent pair1.7%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anicla lubricanssame genus2.3%Anicla tenuescenssame genus3.3%Anicla sullivanisame genus3.5%Anicla mussame genus4.7%Ochropleura implectasame family5.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type612 records

Wild obs. + sensor322

Museum / vouchered290

Range

Area of Occupancy AOO1 196 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 165≤1 km 49≤10 km 10>10 km 36

260 georeferenced · 62 without coordinates

Open the mapobservation + sensor322

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy28% within 1 km

≤100 m 15≤1 km 36≤10 km 119>10 km 10

180 georeferenced · 110 without coordinates

Open the institutions mapphysical evidence290

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
New Haven, US	114
University of Alberta Museums (UAM)location not on record	40
East Lansing, US	39
North Carolina State University Insect Museumlocation not on record	24
ASUlocation not on record	21
Mississippi State, US	5
Cornell University Insect Collectionlocation not on record	5
University of Guelph, Centre for Biodiversity Genomicslocation not on record	3
St. Paul, US	3
Natural History Museum of Utahlocation not on record	2
Toronto, CA	2
CUlocation not on record	1
King Saud Universitylocation not on record	1
Helsinki, FI	1

14 institutions · 261 of 290 vouchered records shown · 29 without an institution code

09Environmental DNA36 detections

Where the DNA of Anicla illapsa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found36

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 36 detections have coordinates

Open the map2 countries0

Temperate mixed forestScrub, UVL trap

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.1 °C 15.1–26.2

Seasonal swing summer↔winter20.7 °C

Max temp (day)25.4 °C 20.6–31.6

Min temp (night)15.8 °C 10.9–21.1

Precipitation118 mm/mo 80.9–154

Air humidity58.5 % 56.8–62.5

Moisture balance-35.0 mm/mo -62.7–23.0

Vapour deficit1,021 Pa 733–1,407

Wind speed2.80 m/s 1.30–3.80

Cloud cover34.7 % 27.5–42.0

CHELSA 1981–2010, ~9 km grid, at location & month of 34 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)