Anicla ignicans

Guenée, 1852 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Anicla

At a glance

Occurrence records235

Data sources6

Biological traits0

DNA specimens55

eDNA detections56

Sources6 archives

Databases and archives Anicla ignicans's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility235 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI56 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics55 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF235 records

Environmental DNA1 datasets · 4 countries56 detections

DNA & barcodingBOLD55 specimens

01Narrative

Anicla ignicans is een vlinder uit de familie van de uilen (Noctuidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1852 door Guenée.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding55 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anicla ignicans has left across the world's sequence archives.

At a glance

DNA specimens55

BINs3

Marker genes1

eDNA detections56

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus51 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 91% of positions are identical in every specimen.

Where individuals differ — all 57 variable positions, in barcode order

10Cmostly conserved

34Amostly conserved

82Cmostly conserved

85Amostly conserved

100Amostly conserved

127Cmostly conserved

142Cmostly conserved

160Gmostly conserved

172Cmostly conserved

181Gmostly conserved

187Cmostly conserved

202Tmostly conserved

206Cmostly conserved

214Gmostly conserved

217Gmostly conserved

220Tmostly conserved

235Cmostly conserved

268Amostly conserved

304Cmostly conserved

313Tmostly conserved

340Cmostly conserved

343Cmostly conserved

352Tmostly conserved

355Cmostly conserved

370Gmostly conserved

376Tmostly conserved

382Amostly conserved

388Tmostly conserved

400Tmostly conserved

412Tmostly conserved

433Gmostly conserved

436Amostly conserved

445Cmostly conserved

448Cmostly conserved

451Cmostly conserved

470Tmostly conserved

472Amostly conserved

477Gmostly conserved

478Amostly conserved

517Amostly conserved

529Avariable

547Gmostly conserved

548Cmostly conserved

553Cmostly conserved

562Cmostly conserved

574Tmostly conserved

596Cmostly conserved

598Tmostly conserved

604Cmostly conserved

607Cmostly conserved

616Cmostly conserved

619Amostly conserved

622Gmostly conserved

628Gmostly conserved

641Tmostly conserved

646Tmostly conserved

652Cmostly conserved

AACATTATACTTTATTTTTGGTATTTGAGCTGGAATAGTAGGAACATCATTAAGATTATTAATTCGAGCTGAATTAGGAAACCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.4%

Haplotypes15

BINs3

Most divergent pair8.5%

N.AmericaS.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Protogygia polingisame family7.0%Agrotis turatiisame family7.1%Agrotis apicalissame family7.1%Agrotis buchholzisame family7.1%Protogygia biclavissame family7.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type235 records

Wild obs. + sensor29

Museum / vouchered206

Range

Area of Occupancy AOO340 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 12≤1 km 2≤10 km 2

16 georeferenced · 13 without coordinates

Open the mapobservation + sensor29

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 2

2 georeferenced · 204 without coordinates

Open the institutions mapphysical evidence206

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
National Biodiversity Institute, Costa Ricalocation not on record	175
University of Pennsylvanialocation not on record	7
PUC-RSlocation not on record	3
Ciudad de México, MX	2
ZSMlocation not on record	1

5 institutions · 188 of 206 vouchered records shown · 18 without an institution code

09Environmental DNA56 detections

Where the DNA of Anicla ignicans was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found56

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 56 detections have coordinates

Open the map4 countries0

1. Forest & Woodland|1.9. Subtropical/Tropic…1. Forest & Woodland | 1.6. Subtropical/Trop…1. Forest & Woodland | 1.9. Subtropical/Trop…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.2 °C 16.2–26.4

Seasonal swing summer↔winter2.40 °C

Max temp (day)27.2 °C 19.3–30.1

Min temp (night)21.1 °C 13.7–23.0

Precipitation130 mm/mo 15.8–379

Air humidity64.9 % 59.2–70.8

Moisture balance13.0 mm/mo -154–229

Vapour deficit966 Pa 539–1,304

Wind speed2.50 m/s 1.30–5.10

Cloud cover30.6 % 13.5–45.7

CHELSA 1981–2010, ~9 km grid, at location & month of 56 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)