Anicla exuberans

Smith, 1898 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Anicla

At a glance

Occurrence records371

Data sources5

Biological traits0

DNA specimens23

eDNA detections23

Sources5 archives

Databases and archives Anicla exuberans's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility371 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI23 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics23 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF371 records

Environmental DNA1 datasets · 2 countries23 detections

DNA & barcodingBOLD23 specimens

01Narrative

Anicla exuberans is a moth of the family Noctuidae first described by John Bernhardt Smith in 1898. It is found in North America from central Mexico north to the dry interior of southern British Columbia, southern Alberta and south-western Saskatchewan. The wingspan is 37–41 mm. Adults are on wing from June to August depending on the location. There is one generation per year.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding23 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anicla exuberans has left across the world's sequence archives.

At a glance

DNA specimens23

BINs1

Marker genes1

eDNA detections23

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus23 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 8 variable positions, in barcode order

73Gmostly conserved

85Gmostly conserved

181Tmostly conserved

370Gmostly conserved

415Tmostly conserved

557Tmostly conserved

607Tmostly conserved

616Cmostly conserved

AACATTATATTTTATTTTTGGTATTTGAGCTGGTATAGTAGGAACATCCTTAAGATTATTAATTCGAGCTGAGTTAGGAAACCCGGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.39%

Haplotypes3

BIN1

Most divergent pair1.2%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anicla sullivanisame genus4.3%Anicla lubricanssame genus4.3%Anicla tepperisame genus4.7%Anicla mussame genus4.7%Anicla forbesisame genus4.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type371 records

Wild obs. + sensor33

Museum / vouchered338

Range

Area of Occupancy AOO492 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy22% within 1 km

≤100 m 1≤1 km 5≤10 km 19>10 km 2

27 georeferenced · 6 without coordinates

Open the mapobservation + sensor33

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy67% within 1 km

≤100 m 72≤1 km 78≤10 km 61>10 km 14

225 georeferenced · 113 without coordinates

Open the institutions mapphysical evidence338

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Colorado State Universitylocation not on record	116
ASUlocation not on record	73
University of Alberta Museums (UAM)location not on record	46
East Lansing, US	31
New Haven, US	17
Mississippi State, US	16
Royal Saskatchewan Museumlocation not on record	5
US	5
University of Guelph, Centre for Biodiversity Genomicslocation not on record	4
Albuquerque, US	3
Cornell University Insect Collectionlocation not on record	1
München, DE	1
Georgia Museum of Natural Historylocation not on record	1

13 institutions · 319 of 338 vouchered records shown · 19 without an institution code

09Environmental DNA23 detections

Where the DNA of Anicla exuberans was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found23

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 23 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.9 °C 15.9–23.7

Seasonal swing summer↔winter24.9 °C

Max temp (day)24.4 °C 22.5–30.2

Min temp (night)11.2 °C 9.10–16.9

Precipitation35.4 mm/mo 28.7–49.5

Air humidity51.1 % 50.7–52.2

Moisture balance-102 mm/mo -119–-69.6

Vapour deficit985 Pa 892–1,448

Wind speed2.50 m/s 1.70–2.60

Cloud cover38.6 % 24.6–42.1

CHELSA 1981–2010, ~9 km grid, at location & month of 21 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)