Aniba rosaeodora

Ducke · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Laurales/Lauraceae/Aniba

At a glance

Occurrence records176

Data sources11

Biological traits7

DNA specimens0

eDNA detections0

Sources11 archives

Databases and archives Aniba rosaeodora's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility176 records↗

NCBIUS National Library of Medicinesequences↗

dukesphytochemcompounds

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources7 traits

Chemical compositionDukesPhytochem · LOTUS · NPASS100 compounds

Occurrence & distributionGBIF176 records

DNA & barcodingNCBIsequences

Genome at a glanceGoaTgenome

01Narrative

Aniba rosaeodora oder Rosenholzbaum, auch wie manche andere Arten Rosenholz genannt, ist eine Pflanzenart aus der Gattung Aniba innerhalb der Familie der Lorbeergewächse (Lauraceae). Die Art unterliegt dem Washingtoner Artenschutzabkommen. Aniba rosaeodora und Aniba parviflora u. a. wie Aniba terminalis und Aniba panurensis, liefern Rosenholzöl und werden oft verwechselt. Aniba rosaeodora, der „echte Rosenholzbaum“, liefert allerdings das qualitativ bessere Öl.Victor R. Preedy: Essential Oils in Food Preservation, Flavor and Safety. Academic Press, 2016, ISBN 978-0-12-416641-7, S. 193–200.Aniba bei Useful Tropical Plants. In Brasilien wird Aniba rosaeodora auch als „Pau-rosa“ bezeichnet, allerdings wird diese Bezeichnung auch für einige andere Arten mit rotem Holz verwendet.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesTRY

Size & morphology2

Leaf size29 000 mm²

Seed length27.28 mm

Life cycle & reproduction1

Deciduousnessevergreen

Habitat & environment2

Growth formtree

Woodinesswoody

Physiology & chemistry2

Photosynthetic pathwayC3

Wood density733 mg/cm³

03Chemical composition100 compounds

Compounds documented for Aniba rosaeodora across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

💊 Medicinal use documented

Compound class profile5 classes

Simple coumarins9

Dihydroflavonols6

Stigmastane steroids5

Cadinane sesquiterpenoids4

Acyclic monoterpenoids4

Documented compounds100 total

Tissue Source Quantified only

Compound	Amount	Source
SESQUITERPENES	60,000 ppm	DukesPhytochem
CITRAL	1,500 ppm	DukesPhytochem
BENZALDEHYDE	300 ppm	DukesPhytochem

05DNA & barcoding4 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aniba rosaeodora has left across the world's sequence archives.

At a glance

Marker genes3

GenBank sequences4

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMW489501.1 ↗244 bpBrazil · 2020

ACGT

GAGCTCCGAACAAACCCTCTGGGAGTGGCGAGCACCAAGGAATCGAAGCGGAAAGGGCGGCCGCCTTGCCAGGTGGGGGCACACCCCGAA …

Aniba rosaeodora voucher MG229347 internal transcribed spacer 1 and 5.8S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL2★ITS1

plant barcodefungal barcode

06Genome at a glanceGoaT

The complete instruction manual Aniba rosaeodora carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Ploidydiploid inferred

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type176 records

Wild obs. + sensor1

Museum / vouchered175

Range

Area of Occupancy AOO212 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤100 m 1>10 km 1

2 georeferenced · 173 without coordinates

Open the institutions mapphysical evidence175

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record	42
Bronx, US	39
Santarém, BR	20
Ivano-Frankivsk, UA	16
Chicago, US	15
University of Stellenboschlocation not on record	14
Museu Paraense Emílio Goeldilocation not on record	7
San Jose State University, Museum of Birds and Mammalslocation not on record	5
Istituto Agrario Castelnuovolocation not on record	3
USP-IBlocation not on record	2
IPA/SPlocation not on record	2
Universidad de Nariño (UdeNar)location not on record	1
Santiago de Cali, CO	1
Bogotá, D.C., CO	1

14 institutions · 168 of 175 vouchered records shown · 7 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)