Anguliphantes angulipalpis

(Westring, 1851) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Linyphiidae/Anguliphantes

At a glance

Occurrence records826

Data sources7

Biological traits11

DNA specimens16

eDNA detections45

Sources7 archives

Databases and archives Anguliphantes angulipalpis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility826 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI45 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics16 specimens↗

World Spider Trait DBMasaryk University11 traits · 23 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements23 literature sources11 traits

Occurrence & distributionGBIF826 records

Environmental DNA3 datasets · 6 countries45 detections

DNA & barcodingBOLD16 specimens

01Narrative

Het geknikte bodemwevertje is een spinnensoort in de taxonomische indeling van de hangmatspinnen (Linyphiidae). Het wevertje is een kleine spin. Zijn lichaam is tweeledig. Het dier behoort tot het geslacht Anguliphantes. De wetenschappelijke naam van de soort werd voor het eerst geldig gepubliceerd in 1851 door Johan Peter Westring. De spin komt voor in Scandinavië.

No narrative description available for this taxon yet.

02Traits & measurements

Compiled from 23 sources

Birkhofer et al. 2017Entling et al. 2007Buchar & Růžička 2002Henriksen & Hilmo 2015SLU 2020Staręga et al. 2001Gajdoš et al. 2014Bruun & Lissner 2019Hyvärinen et al. 2019Řezáč et al. 2015Blick et al. 2016Nährig et al. 2003Kielhorn 2017Finch 2004Martin 2012Buchholz et al. 2011Hiebsch & Tolke 1996Sacher & Platen 2004Lemke et al. 2013Liste France 2018Blick & Scheidler 2004Nentwig et al. 2018Cardoso et al. 2011

Morphometry1

Body length♀2.35·♂2.35 mm

Predation2

Hunting guildsheet web weavers

Simple hunting guild classificationcursorial

Ecology8

Ballooninglow

Light0.5 mm

Light 2partly shaded

Moisture 10.5 mm

Moisture 2semi-humid

Regional IUCN Red List categoryLeast Concern (LC)

Regional non-IUCN Red List categoryLeast Concern (LC)

Stratumvegetation

05DNA & barcoding16 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anguliphantes angulipalpis has left across the world's sequence archives.

At a glance

DNA specimens16

BINs2

Marker genes1

eDNA detections45

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P654 bp consensus15 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Diversity (π)0.35%

Haplotypes2

BINs2

Most divergent pair0.15%

Where individuals differ — all 15 variable positions, in barcode order

18Amostly conserved

78Amostly conserved

99Amostly conserved

105Cmostly conserved

213Amostly conserved

219Cmostly conserved

249Cmostly conserved

270Tmostly conserved

342Tmostly conserved

363Amostly conserved

375Cmostly conserved

450Gmostly conserved

456Cmostly conserved

495Gmostly conserved

597Tmostly conserved

ACGTTATATTTTATTTTAGGGGCTTGAGCTGCTATAGTGGGGACTGCCATAAGAGTATTAATTCGAATTGAATTGGGACAAACAGGAAGA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Oryphantes bipilissame family9.0%Improphantes complicatussame family9.3%Oryphantes angulatussame family9.6%Lepthyphantes nodifersame family9.6%Anguliphantes dybowskiisame genus10.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type826 records

Wild obs. + sensor248

Museum / vouchered577

Cultivated / captive1

Origin

Native55

Range

Area of Occupancy AOO1 128 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤100 m 174≤1 km 63≤10 km 10

247 georeferenced · 1 without coordinates

Open the mapobservation + sensor248

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy53% within 1 km

≤100 m 34≤1 km 120≤10 km 93>10 km 42

289 georeferenced · 288 without coordinates

Open the institutions mapphysical evidence577

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 26 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Adam Mickiewicz University in Poznańlocation not on record	162
Helsinki, FI	130
Ekaterinburg, RU	45
Paro, BT	45
Institute of Plant and Animal Ecology (IPAE), UB RASlocation not on record	42
Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record	34
SLU Artdatabankenlocation not on record	30
Frankfurt am Main	15
Uniwersytet w Białymstokulocation not on record	11
Tartu, EE	7
Bonn, DE	7
Prioksko-Terrasnyi Biosphere Reservelocation not on record	7
Zoologisches Museum Hamburglocation not on record	6
Akademia Pomorska w Słupskulocation not on record	3
NHMOlocation not on record	3
University of Tokyo, Department of Zoologylocation not on record	2
ZSMlocation not on record	2
Muzeum i Instytut Zoologii Polskiej Akademii Nauklocation not on record	2
SNSB-Zoologische Staatssammlung Münchenlocation not on record	2
neflocation not on record	2
RMZlocation not on record	1
Metsähallituslocation not on record	1
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	1
NTNU-VMlocation not on record	1
NTNU University Museum, Department of Natural Historylocation not on record	1
Copenhagen, DK	1

26 institutions · 563 of 577 vouchered records shown · 14 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA45 detections

Where the DNA of Anguliphantes angulipalpis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found45

Studies independent surveys3

Countries6

Verifiable raw sequence linked29

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 45 detections have coordinates

Open the map6 countries0

Alpine heath

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median7.10 °C 0.8–13.0

Seasonal swing summer↔winter19.8 °C

Max temp (day)9.50 °C 2.80–16.9

Min temp (night)5.00 °C -1.40–8.10

Precipitation58.4 mm/mo 46.9–70.4

Air humidity66.4 % 60.5–68.6

Moisture balance26.9 mm/mo -20.2–42.7

Vapour deficit341 Pa 207–635

Wind speed3.50 m/s 2.90–5.00

Cloud cover52.2 % 46.0–59.7

CHELSA 1981–2010, ~9 km grid, at location & month of 45 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)