Anguispira kochi

(L.Pfeiffer, 1846) · species

image placeholder — illustration coming later

Animalia/Mollusca/Gastropoda/Stylommatophora/Discidae/Anguispira

At a glance

Occurrence records594

Data sources7

Biological traits0

DNA specimens143

eDNA detections140

Sources7 archives

Databases and archives Anguispira kochi's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility594 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI140 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics143 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF594 records

Environmental DNA1 datasets · 2 countries140 detections

DNA & barcodingBOLD143 specimens

01Narrative

Anguispira kochi is a species of gastropods belonging to the family Discidae. There are two subspecies, Anguispira kochi kochi or Eastern Banded Tigersnail, and Anguispira kochi occidentalis or Western Banded Tigersnail. The Eastern Banded Tigersnail was declared Endangered in Canada in 2017. The species is found in Northern America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding143 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anguispira kochi has left across the world's sequence archives.

At a glance

DNA specimens143

BINs19

Marker genes1

eDNA detections140

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P666 bp consensus134 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 85% of positions are identical in every specimen.

Where individuals differ — all 97 variable positions, in barcode order

15Cmostly conserved

21Tmostly conserved

25Cmostly conserved

33Tmostly conserved

36Gmostly conserved

45Tmostly conserved

54Tmostly conserved

57Amostly conserved

60Cmostly conserved

61Tmostly conserved

63Gmostly conserved

69Gmostly conserved

72Amostly conserved

78Tmostly conserved

79Cmostly conserved

81Cmostly conserved

84Gmostly conserved

90Tvariable

93Gmostly conserved

96Amostly conserved

99Gmostly conserved

102Amostly conserved

105Gmostly conserved

138Cmostly conserved

141Gmostly conserved

153Amostly conserved

165Tmostly conserved

168Gmostly conserved

171Amostly conserved

177Tmostly conserved

180Tmostly conserved

183Gmostly conserved

189Amostly conserved

195Tmostly conserved

198Tmostly conserved

207Gmostly conserved

210Amostly conserved

213Tvariable

214Tmostly conserved

217Cmostly conserved

222Cmostly conserved

225Tmostly conserved

228Gmostly conserved

231Gmostly conserved

240Amostly conserved

243Tmostly conserved

255Cvariable

258Cmostly conserved

274Tmostly conserved

276Amostly conserved

279Tmostly conserved

288Cmostly conserved

291Amostly conserved

292Tmostly conserved

306Tmostly conserved

309Tmostly conserved

312Amostly conserved

315Amostly conserved

330Amostly conserved

345Gmostly conserved

354Gmostly conserved

355Cmostly conserved

360Amostly conserved

363Gmostly conserved

366Cmostly conserved

372Amostly conserved

381Gmostly conserved

387Cmostly conserved

393Tmostly conserved

408Cmostly conserved

420Cmostly conserved

423Avariable

429Amostly conserved

435Cmostly conserved

438Amostly conserved

444Tmostly conserved

447Tmostly conserved

462Tmostly conserved

465Cmostly conserved

495Tmostly conserved

501Cmostly conserved

513Cmostly conserved

516Avariable

550Cmostly conserved

555Cmostly conserved

564Tmostly conserved

570Tmostly conserved

576Amostly conserved

586Cmostly conserved

591Cmostly conserved

597Cmostly conserved

624Tmostly conserved

627Cmostly conserved

636Gmostly conserved

639Gmostly conserved

648Cmostly conserved

649Cmostly conserved

AAAGATATTGGTACCTTATATATACTATTTGGTGTGTGATGTGGTATAATTGGTTCAGGCTTGTCATTGTTAATTCGTCTCGAGCTAGGT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)4.4%

Haplotypes7

BINs19

Most divergent pair4.2%

Other

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type594 records

Wild obs. + sensor42

Museum / vouchered549

Fossil3

Range

Area of Occupancy AOO1 528 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 16≤1 km 9≤10 km 2>10 km 3

30 georeferenced · 12 without coordinates

Open the mapobservation + sensor42

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy32% within 1 km

≤100 m 10≤1 km 27≤10 km 51>10 km 29

117 georeferenced · 432 without coordinates

Open the institutions mapphysical evidence549

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Philadelphia, US	132
Chicago, US	77
Delaware Museum of Nature and Sciencelocation not on record	73
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	61
Champaign, US	55
Chongqing Museumlocation not on record	41
Cambridge, US	35
Santa Barbara Museum of Natural Historylocation not on record	13
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	11
Victoria, CA	11
Chicago, US	9
University of Guelph, Centre for Biodiversity Genomicslocation not on record	8
Ann Arbor, US	8
Denver, US	2
Museo Enrico Pirajno di Mandralisca \| Enrico Pirajno di Mandralisca Museumlocation not on record	1
Saint John, CA	1
Centre for Biodiversity Genomicslocation not on record	1

17 institutions · 539 of 549 vouchered records shown · 10 without an institution code

09Environmental DNA140 detections

Where the DNA of Anguispira kochi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found140

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 140 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.7 °C 0.5–23.4

Seasonal swing summer↔winter27.7 °C

Max temp (day)16.6 °C 3.60–25.9

Min temp (night)7.70 °C -1.60–21.7

Precipitation83.0 mm/mo 52.3–93.7

Air humidity58.8 % 52.5–61.1

Moisture balance-34.1 mm/mo -88.3–21.4

Vapour deficit633 Pa 248–1,165

Wind speed5.40 m/s 1.90–6.70

Cloud cover40.6 % 34.5–47.7

CHELSA 1981–2010, ~9 km grid, at location & month of 14 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)