Anguillicola crassus

Kuwahara, Niimi & Itagaki, 1974 · species

image placeholder — illustration coming later

Animalia/Nematoda/Chromadorea/Rhabditida/Anguillicolidae/Anguillicola

At a glance

Occurrence records227

Data sources7

Biological traits2

DNA specimens561

eDNA detections562

Sources7 archives

Databases and archives Anguillicola crassus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility199 records↗

OBISOcean Biodiversity Information System28 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI562 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics561 specimens↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF · OBIS227 records

Environmental DNA1 datasets · 9 countries562 detections

DNA & barcodingBOLD561 specimens

01Narrative

Anguillicola crassus, ou Anguillicoloides crassus, est une espèce de vers nématodes marins, originaire d'Asie. C'est un endoparasite qui colonise la cavité abdominale de l'anguille et se fixe ensuite dans sa vessie natatoire, causant une maladie (parasitose) dénommée anguillicolose.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat freshwateryes

Habitat zonehost

05DNA & barcoding561 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anguillicola crassus has left across the world's sequence archives.

At a glance

DNA specimens561

BINs1

Marker genes1

eDNA detections562

Countries16

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P524 bp consensus142 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 11 variable positions, in barcode order

24Amostly conserved

318Tmostly conserved

319Gmostly conserved

324Cmostly conserved

329Tmostly conserved

384Amostly conserved

390Tvariable

484Tmostly conserved

493Cmostly conserved

507Tmostly conserved

514Cmostly conserved

ATTCGTTTTGAGCTTTCTATACCAGGCCTTTTGTTAGGTGATGGGCAATTATATAATTGTATTATTACGTCTCATGCAATTGTTATAATT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens. Showing the 28 commonest of 43 variants.

Diversity (π)0.85%

Haplotypes43

BIN1

Most divergent pair3.4%

N.AmericaEuropeAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anguillicola australiensissame genus11.3%Anguillicola papernaisame genus13.0%Anguillicola novaezelandiaesame genus13.4%Toxascaris leoninasame order16.6%Steinernema carpocapsaesame order17.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type227 records

Wild obs. + sensor25

Museum / vouchered116

Other86

Range

Area of Occupancy AOO260 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤100 m 17≤1 km 7>10 km 1

25 georeferenced

Open the mapobservation + sensor25

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 116 records without

Open the institutions mapphysical evidence116

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Toronto, CA	25
Klaipeda University Marine research institutelocation not on record	4
Washington, US	1

3 institutions · 30 of 116 vouchered records shown · 86 without an institution code

09Environmental DNA562 detections

Where the DNA of Anguillicola crassus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found562

Studies independent surveys1

Countries9

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 562 detections have coordinates

Open the map9 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.4 °C 8.30–18.9

Seasonal swing summer↔winter22.7 °C

Max temp (day)14.2 °C 11.9–22.0

Min temp (night)7.50 °C 3.10–14.7

Precipitation106 mm/mo 13.8–328

Air humidity59.9 % 45.7–65.0

Moisture balance3.60 mm/mo -95.2–229

Vapour deficit565 Pa 449–827

Wind speed3.70 m/s 1.90–6.40

Cloud cover47.8 % 24.1–54.3

CHELSA 1981–2010, ~9 km grid, at location & month of 90 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)