Angraecum pectinatum

Thouars · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Angraecum

At a glance

Occurrence records265

Data sources7

Biological traits10

DNA specimens11

eDNA detections6

Sources7 archives

Databases and archives Angraecum pectinatum's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility265 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Occurrence & distributionGBIF265 records

Environmental DNA1 datasets · 1 countries6 detections

DNA & barcodingBOLD · NCBI11 specimens

01Narrative

Angraecum pectinatum is a species of orchid native to Madagascar, Mauritius, Réunion, and Comoros.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction3

Life formepiphytic or lithophytic chamaephyte

Life spanperennial

Raunkiær life formchamaephyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteobligatory

Growth formshrub

⚠ sources differ — GIFT: shrub · TRY: Epiphyte

Woodinesswoody

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Angraecum pectinatum has left across the world's sequence archives.

At a glance

DNA specimens11

Marker genes3

GenBank sequences5

eDNA detections6

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMH237222.1 ↗342 bp

ACGT

GTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAGACCAAAATATATCGAGCGATTCGGAGAACCCGTGAAAAAAGCGG …

Angraecum pectinatum isolate CM6h 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, complete sequence; and 5.8S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcLa★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type265 records

Wild obs. + sensor245

Museum / vouchered20

Range

Area of Occupancy AOO236 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy9% within 1 km

≤100 m 14≤1 km 8≤10 km 106>10 km 104

232 georeferenced · 13 without coordinates

Open the mapobservation + sensor245

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 19 without coordinates

Open the institutions mapphysical evidence20

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
No Herbarium Samplelocation not on record	6
BRLUlocation not on record	4
Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record	2
Plocation not on record	1
Centre National de la Recherche Appliquée au Developement Rurallocation not on record	1
Saint Louis, US	1
South Kensington, GB	1

7 institutions · 16 of 20 vouchered records shown · 4 without an institution code

09Environmental DNA6 detections

Where the DNA of Angraecum pectinatum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.0 °C 25.0–25.0

Seasonal swing summer↔winter2.90 °C

Max temp (day)29.4 °C

Min temp (night)21.1 °C

Precipitation546 mm/mo

Air humidity68.5 %

Moisture balance385 mm/mo

Vapour deficit994 Pa

Wind speed0.6 m/s

Cloud cover31.4 %

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)