Angraecum equitans

Schltr. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Angraecum

At a glance

Occurrence records37

Data sources7

Biological traits10

DNA specimens2

eDNA detections2

Sources7 archives

Databases and archives Angraecum equitans's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility37 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Occurrence & distributionGBIF37 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Angraecum equitans là một loài thực vật có hoa trong họ Lan. Loài này được Schltr. mô tả khoa học đầu tiên năm 1916.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction3

Life formepiphytic subshrub

Life spanperennial

Raunkiær life formchamaephyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteobligatory

Growth formshrub

⚠ sources differ — GIFT: shrub · TRY: Epiphyte

Woodinesswoody

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Angraecum equitans has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences1

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

matKMW435916.1 ↗1 110 bp

ACGT

TTTTTGGTTAAAGTAGAAATGTATTTAAATGACAGAATTACAAGGATATTTAGATTGAAAAAAGAGAGATTTCGGCAACAAAACTTCCTA …

Angraecum equitans voucher Verlynde 52 [BRLU] maturase K (matK) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcLa

plant barcode

08Occurrence & distribution

Record type37 records

Wild obs. + sensor2

Museum / vouchered35

Range

Area of Occupancy AOO64 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 2

2 georeferenced

Open the mapobservation + sensor2

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 35 records without

Open the institutions mapphysical evidence35

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record	5
BRLUlocation not on record	2
Plocation not on record	2
Paris, FR	1
Unknownlocation not on record	1
Uppsala, SE	1
No Herbarium Samplelocation not on record	1
Universite de Montreal, L'Herbier Marie-Victorinlocation not on record	1

8 institutions · 14 of 35 vouchered records shown · 21 without an institution code

09Environmental DNA2 detections

Where the DNA of Angraecum equitans was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.9 °C 18.5–21.3

Seasonal swing summer↔winter6.60 °C

Max temp (day)23.7 °C 22.5–24.9

Min temp (night)16.1 °C 14.5–17.7

Precipitation271 mm/mo 146–396

Air humidity70.4 % 69.7–71.2

Moisture balance132 mm/mo 12.5–252

Vapour deficit688 Pa 645–731

Wind speed1.70 m/s 1.60–1.70

Cloud cover34.8 % 17.9–51.8

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)