Angraecum eburneum

Bory · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Angraecum

At a glance

Occurrence records885

Data sources8

Biological traits13

DNA specimens34

eDNA detections23

Sources8 archives

Databases and archives Angraecum eburneum's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility885 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI23 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics34 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources13 traits

Occurrence & distributionGBIF885 records

Environmental DNA1 datasets · 1 countries23 detections

DNA & barcodingBOLD · NCBI34 specimens

Genome at a glanceCCDB2n = 38

01Narrative

Angraecum eburneum Bory, est une espèce d'orchidée décrite pour la première fois en 1804 par le naturaliste Bory de Saint-Vincent d'après un spécimen découvert sur une arête rocheuse à l'Îlet à Guillaume, au sud de Saint-Denis de la Réunion, le 29 août 1801. Si l'espèce type est originaire de La Réunion, Angraecum eburneum est répandu dans toutes les îles de l'ouest de l'Océan indien.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology2

Plant height0.2 m

Seed mass0.0 mg

Life cycle & reproduction3

Life formepiphyte

Life spanperennial

Raunkiær life formchamaephyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteobligatory

Growth formherb

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

05DNA & barcoding34 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Angraecum eburneum has left across the world's sequence archives.

At a glance

DNA specimens34

Marker genes5

GenBank sequences10

eDNA detections23

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMH236970.1 ↗320 bpKenya · 2010

ACGT

CAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAGACCAAAATATATCGAGCGATTCGGAGAACCCGTGAAAGAAGCGGCGGC …

Angraecum eburneum subsp. giryamae isolate 1509 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, complete sequence; and 5.8S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL3★rbcLa★ITS5★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Angraecum eburneum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 38 n = 19

Ploidypolyploid inferred

Chromosome records38–382n range38median38mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 382×CCDB · book-ipcn67-71 · CCDB · Cave1963

CCDB · book-ipcn67-71 — JONES, K. 1967. The chromosomes of Orchids: II Vandeae Lindl. Kew Bull. 21: 151-156.

CCDB · Cave1963 — Shindo & Kam. 1963a

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type885 records

Wild obs. + sensor804

Museum / vouchered81

Range

Area of Occupancy AOO700 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy8% within 1 km

≤100 m 44≤1 km 18≤10 km 368>10 km 340

770 georeferenced · 34 without coordinates

Open the mapobservation + sensor804

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 1≤1 km 1

2 georeferenced · 79 without coordinates

Open the institutions mapphysical evidence81

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Plocation not on record	15
No Herbarium Samplelocation not on record	12
Saint Louis, US	8
Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record	5
Paris, FR	4
BRLUlocation not on record	3
Centre National de la Recherche Appliquée au Developement Rurallocation not on record	3
South Kensington, GB	3
Kew, GB	2
MeiseBGlocation not on record	2
Bronx, US	1
MAlocation not on record	1
Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record	1
CJBGlocation not on record	1
Chongqing Museumlocation not on record	1
St. Augustine, TT	1

16 institutions · 63 of 81 vouchered records shown · 18 without an institution code

09Environmental DNA23 detections

Where the DNA of Angraecum eburneum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found23

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 23 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.9 °C 24.7–26.6

Seasonal swing summer↔winter6.80 °C

Max temp (day)29.2 °C 27.6–29.7

Min temp (night)22.2 °C 20.3–25.2

Precipitation363 mm/mo 197–451

Air humidity67.0 % 64.3–67.0

Moisture balance197 mm/mo

Vapour deficit1,098 Pa 1,096–1,201

Wind speed2.10 m/s

Cloud cover57.4 % 27.0–57.4

CHELSA 1981–2010, ~9 km grid, at location & month of 14 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)