Angophora woodsiana

F.M.Bailey · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Myrtaceae/Angophora

At a glance

Occurrence records877

Data sources9

Biological traits38

DNA specimens4

eDNA detections2

Sources9 archives

Databases and archives Angophora woodsiana's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility877 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources38 traits

Chemical compositionLOTUS4 compounds

Occurrence & distributionGBIF877 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI4 specimens

01Narrative

Angophora woodsiana, commonly known as smudgee, is a species of small to medium-sized tree that is endemic to eastern Australia. It has rough bark on the trunk and branches, lance-shaped or curved adult leaves, flower buds in groups of three or seven, white or creamy white flowers and ribbed, cup-shaped fruit.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology16

Fruit length13.5 mm

Fruit width12.5 mm

Leaf length90 mm

Leaf length max140 mm

Leaf length min80 mm

Leaf mass per area137 g/m2

Leaf size2 285 mm²

⚠ sources differ — TRY: 2 285 mm² · AusTraits: 2 081 mm²

Leaf width25 mm

Leaf width max30 mm

Leaf width min12 mm

Petiole length1.5 cm

Plant height20 m

Plant height max20 m

Seed mass26.79 mg

Seed mass max35.83 mg

Seed mass min17.75 mg

Life cycle & reproduction7

Deciduousnessevergreen

Flowering timeynnnnnnnnnny

Life formtree

Life spanperennial

Raunkiær life formphanerophyte

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formtree

Leaf compoundnesssimple

Leaf shapefalcate lanceolate

Woodinesswoody

Physiology & chemistry3

Photosynthetic pathwayC3

Specific leaf area (SLA)7.63 mm²/mg

Wood density762 mg/cm³

Other traits1

Plant support typefree-standing

03Chemical composition4 compounds

Compounds documented for Angophora woodsiana across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Flavanones1

Documented compounds4 total

Tissue Source Quantified only

Compound	Amount	Source
(1'R,2R,4S,5'S)-6,6,6',6',8,8-hexamethyl-4-(2-methylpropyl)spiro[3,4-dihydrochromene-2,2'-bicyclo[3.1.1]heptane]-5,7-dione	present	LOTUS
(1R,4R,7S,11S,12R)-1,5,5,15,15,17,17-heptamethyl-8-methylidene-12-(2-methylpropyl)-19-oxatetracyclo[9.8.0.04,7.013,18]nonadec-13(18)-ene-14,16-dione	present	LOTUS
(1R,4R,7S,11S,12S)-1,5,5,15,15,17,17-heptamethyl-8-methylidene-12-(2-methylpropyl)-19-oxatetracyclo[9.8.0.04,7.013,18]nonadec-13(18)-ene-14,16-dione	present	LOTUS
(2S,6R)-5-hydroxy-8,8,10,10,12-pentamethyl-6-(2-methylpropyl)-2-phenyl-3,6-dihydro-2H-chromeno[3,2-g]chromene-4,7,9-trione	present	LOTUS

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Angophora woodsiana has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes4

GenBank sequences6

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSDQ993150.1 ↗544 bp

ACGT

CCGGTATAAAACTCGATGGGGACAGCGAGCTTCACTGGCCGTCCTTCGACGCCAGGGATCGCGTGGGTGCCCCTCGGCAGCACAACGAAC …

Angophora woodsiana isolate 33 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL1★ITS3trnH-psbA

plant barcodefungal barcodemarker

08Occurrence & distribution

Record type877 records

Wild obs. + sensor543

Museum / vouchered148

Cultivated / captive1

Other185

Origin

Native37

Range

Area of Occupancy AOO1 732 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤100 m 457≤1 km 35≤10 km 8>10 km 11

511 georeferenced · 32 without coordinates

Open the mapobservation + sensor543

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy22% within 1 km

≤100 m 18≤1 km 10≤10 km 75>10 km 26

129 georeferenced · 19 without coordinates

Open the institutions mapphysical evidence148

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	60
Mount Annan, AU	37
Canberra, AU	15
La Trobe Universitylocation not on record	15
Armidale, AU	7
Parkville, AU	4
Museo Entomologico de Leonlocation not on record	3
Kew, GB	2
IPA/SPlocation not on record	1
Adelaide, AU	1
University of the Sunshine Coastlocation not on record	1

11 institutions · 146 of 148 vouchered records shown · 2 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Angophora woodsiana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.2 °C 22.2–22.2

Seasonal swing summer↔winter9.00 °C

Max temp (day)25.2 °C

Min temp (night)19.5 °C

Precipitation127 mm/mo

Air humidity59.6 %

Moisture balance-31.6 mm/mo

Vapour deficit1,081 Pa

Wind speed2.40 m/s

Cloud cover21.2 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)