Angophora subvelutina

F.Muell. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Myrtaceae/Angophora

At a glance

Occurrence records2 798

Data sources10

Biological traits40

DNA specimens0

eDNA detections0

Sources10 archives

Databases and archives Angophora subvelutina's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 798 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources40 traits

Chemical compositionLOTUS1 compounds

Occurrence & distributionGBIF2 798 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 22

01Narrative

Flower buds and flowers Angophora subvelutina, commonly known as the broad-leaved apple, is a species of tree that is endemic to eastern Australia. It has rough bark on the trunk and branches, lance-shaped to egg-shaped or elliptical adult leaves, flower buds in groups of three or seven, white or creamy white flowers and ribbed, cup-shaped fruit.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology14

Fruit length9 mm

Fruit width8.5 mm

Leaf length85 mm

Leaf mass180 mg

Leaf mass per area105 g/m2

Leaf size2 110 mm²

Leaf width40 mm

Petiole length0.1 cm

Plant height20 m

Plant height max20 m

Seed length6.5 mm

Seed mass7.26 mg

⚠ sources differ — TRY: 7.26 mg · AusTraits: 8.6 mg · GIFT: 7.26 mg

Seed mass max7.26 mg

Seed mass min7.26 mg

Life cycle & reproduction10

Deciduousnessevergreen

Dispersal typeanimal

Flowering timeyynnnnnnyyyy

Life formtree

Life span>200

⚠ sources differ — TRY: >200 · AusTraits: perennial · GIFT: perennial

Lifespan years200 years

Pollination syndromeinsect

Raunkiær life formphanerophyte

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formtree

Leaf compoundnesssimple

Leaf shapeelliptical lanceolate ovate

Woodinesswoody

Physiology & chemistry4

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)9.83 mm²/mg

Wood density758 mg/cm³

Other traits1

Plant support typefree-standing

03Chemical composition1 compounds

Compounds documented for Angophora subvelutina across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Flavones1

Documented compounds1 total

Tissue Source Quantified only

Compound	Class	Amount	Source
4'-Methylgenkwanin		present	LOTUS

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Angophora subvelutina has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences2

The DNA barcodea real sequence read deposited for this species

ITSKT630900.1 ↗655 bp

ACGT

CAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAATCCTGCCCAGCAGAACGACCAGAGAACCGGTATAAAACTCAATGGGGA …

Angophora subvelutina 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Angophora subvelutina carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 221×CCDB · book-ipcn65

CCDB · book-ipcn65 — Mousel 1965

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type2 798 records

Wild obs. + sensor2 343

Museum / vouchered305

Cultivated / captive6

Other144

Origin

Native98

Range

Area of Occupancy AOO5 600 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy97% within 1 km

≤100 m 2 014≤1 km 163≤10 km 28>10 km 36

2 241 georeferenced · 102 without coordinates

Open the mapobservation + sensor2 343

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy42% within 1 km

≤100 m 68≤1 km 42≤10 km 101>10 km 51

262 georeferenced · 43 without coordinates

Open the institutions mapphysical evidence305

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 2

2 georeferenced · 4 without coordinates

Open the mapnot free-living6

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mount Annan, AU	92
Brisbane, AU	57
Canberra, AU	52
Museo Entomologico de Leonlocation not on record	41
Armidale, AU	24
La Trobe Universitylocation not on record	17
Adelaide, AU	7
Parkville, AU	5
NSW Dept of Planning, Industry and Environmentlocation not on record	2
Bronx, US	1
Wollongong, AU	1
Hobart, AU	1
John T. Waterhouse Herbariumlocation not on record	1
Miami, US	1
Canadian Department of Agriculturelocation not on record	1
Institut und Museum fuer Geologie und Palaeontologielocation not on record	1
Santa Barbara, US	1

17 institutions · 305 of 305 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Angophora subvelutina

At a glance

Sources10 archives

Size & morphology14

Life cycle & reproduction10

Diet & foraging1

Habitat & environment10

Physiology & chemistry4

Other traits1

Compound class profile1 class

Documented compounds1 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type2 798 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions11 of 17 geolocated

Cultivated / Captivenot free-living

Record type2 798 records