Angophora robur

L.A.S.Johnson & K.D.Hill · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Myrtaceae/Angophora

At a glance

Occurrence records2 258

Data sources8

Biological traits29

DNA specimens2

eDNA detections2

Sources8 archives

Databases and archives Angophora robur's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 258 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources29 traits

Occurrence & distributionGBIF2 258 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Angophora robur, commonly known as the sandstone rough-barked apple or the broad-leaved sandstone apple, is a species of small tree that is endemic to a small area in New South Wales. It has rough, fibrous bark on the trunk and branches, lance-shaped to egg-shaped or oblong adult leaves, flower buds in groups of three or seven, white or creamy white flowers and cup-shaped to bell-shaped fruit.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTAusTraitsTRY

Size & morphology9

Fruit length14 mm

Fruit width14 mm

Leaf length115 mm

Leaf width40 mm

Leaf width max100 mm

Petiole length0.05 cm

Plant height10 m

Plant height max10 m

Seed mass18.22 mg

Life cycle & reproduction7

Deciduousnessevergreen

Flowering timennnnnnnnnnny

Life formshrub or tree

Life spanperennial

Raunkiær life formphanerophyte

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formtree

Leaf compoundnesssimple

Leaf shapelanceolate oblong ovate

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Angophora robur has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences4

eDNA detections2

The DNA barcodea real sequence read deposited for this species

ITSDQ993151.1 ↗542 bp

ACGT

CCGGTATACAACTCAATGGGGACAGCGAGCTTCACTGGCCGTCCTTCGACGCCAGGGATCGCGTGGGTGCCTCGGCAGCACAACGAACCC …

Angophora robur isolate 34 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS3

plant barcodefungal barcode

08Occurrence & distribution

Record type2 258 records

Wild obs. + sensor2 198

Museum / vouchered58

Cultivated / captive2

Origin

Native27

Range

Area of Occupancy AOO660 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 2 161≤1 km 32≤10 km 2>10 km 1

2 196 georeferenced · 2 without coordinates

Open the mapobservation + sensor2 198

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy89% within 1 km

≤100 m 21≤1 km 18≤10 km 5

44 georeferenced · 14 without coordinates

Open the institutions mapphysical evidence58

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 2

2 georeferenced

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mount Annan, AU	23
Canberra, AU	19
Armidale, AU	5
Museo Entomologico de Leonlocation not on record	4
Brisbane, AU	3
Adelaide, AU	3
NSW Dept of Planning, Industry and Environmentlocation not on record	1

7 institutions · 58 of 58 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Angophora robur was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Angophora robur

At a glance

Sources8 archives

Size & morphology9

Life cycle & reproduction7

Diet & foraging1

Habitat & environment10

Physiology & chemistry1

Other traits1

At a glance

Record type2 258 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions5 of 7 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Record type2 258 records