Angophora melanoxylon

F.Muell. ex R.T.Baker · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Myrtaceae/Angophora

At a glance

Occurrence records308

Data sources8

Biological traits40

DNA specimens1

eDNA detections1

Sources8 archives

Databases and archives Angophora melanoxylon's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility308 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources40 traits

Occurrence & distributionGBIF308 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Foliage Angophora melanoxylon, commonly known as Coolabah apple, is a species of small to medium-sized tree that is endemic to eastern Australia. It has rough, fibrous bark on the trunk and branches, linear to narrow lance-shaped adult leaves, flower buds in groups of three or seven, white or creamy white flowers and cup-shaped, cylindrical or barrel-shaped fruit.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology17

Fruit length10.5 mm

Fruit width9 mm

Leaf length62.5 mm

Leaf length max90 mm

Leaf mass96.22 mg

Leaf mass per area186 g/m2

Leaf size516 mm²

Leaf width15 mm

Leaf width max27 mm

Petiole length0.25 cm

Plant height15 m

Plant height max15 m

Seed length6.13 mm

Seed mass7.9 mg

⚠ sources differ — TRY: 7.9 mg · AusTraits: 0.007 mg · GIFT: 7.86 mg

Seed mass max7.86 mg

Seed mass min7.86 mg

Seed width4.31 mm

Life cycle & reproduction9

Deciduousnessevergreen

Dispersal typeanimal

Flowering timeyynnnnnnyyyy

Life formtree

Life spanperennial

Pollination syndromeinsect

Raunkiær life formphanerophyte

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formtree

Leaf compoundnesssimple

Leaf shapelinear narrowly_elliptical narrowly_lanceolate

Woodinesswoody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Angophora melanoxylon has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes3

GenBank sequences3

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSKT630898.1 ↗559 bp

ACGT

AGACATTGTCGATCCTGCCTAGCAGAACGACCAGAGAACCAGTATAAAACTCAATGGGGAAGGTGAGCTCCGCTGGCCGTCCCCCGACGT …

Angophora melanoxylon 18S ribosomal RNA gene, partial sequence; and internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS2★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type308 records

Wild obs. + sensor93

Museum / vouchered206

Cultivated / captive6

Other3

Origin

Native61

Introduced2

Range

Area of Occupancy AOO648 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 54≤1 km 9≤10 km 5

68 georeferenced · 25 without coordinates

Open the mapobservation + sensor93

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy43% within 1 km

≤100 m 22≤1 km 56≤10 km 78>10 km 26

182 georeferenced · 24 without coordinates

Open the institutions mapphysical evidence206

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy80% within 1 km

≤100 m 2≤1 km 2≤10 km 1

5 georeferenced · 1 without coordinates

Open the mapnot free-living6

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mount Annan, AU	63
Canberra, AU	55
Brisbane, AU	43
Armidale, AU	15
Museo Entomologico de Leonlocation not on record	8
La Trobe Universitylocation not on record	7
Parkville, AU	4
Adelaide, AU	3
Hobart, AU	2
John T. Waterhouse Herbariumlocation not on record	2
NSW Dept of Planning, Industry and Environmentlocation not on record	1
Kew, GB	1
Smithfield, AU	1

13 institutions · 205 of 206 vouchered records shown · 1 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Angophora melanoxylon was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)