Angophora leiocarpa

(L.A.S.Johnson ex G.J.Leach) K.R.Thiele & Ladiges · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Myrtaceae/Angophora

At a glance

Occurrence records3 206

Data sources9

Biological traits40

DNA specimens2

eDNA detections2

Sources9 archives

Databases and archives Angophora leiocarpa's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 206 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources40 traits

Occurrence & distributionGBIF3 206 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Angophora leiocarpa, commonly known as rusty gum, is a species of small to medium-sized tree that is endemic to eastern Australia. It has smooth bark on the trunk and branches, lance-shaped adult leaves, flower buds usually in groups of three, white or creamy white flowers and smooth barrel-shaped to cup-shaped fruit.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology15

Fruit length11.5 mm

Fruit width9.5 mm

Leaf length105 mm

Leaf length max100 mm

Leaf mass per area154 g/m2

Leaf size1 735 mm²

Leaf width16 mm

Leaf width max15 mm

Petiole length1.25 cm

Plant height25 m

Plant height max25 m

Seed length7 mm

Seed mass12.47 mg

Seed mass max12.47 mg

Seed mass min12.47 mg

Life cycle & reproduction9

Deciduousnessevergreen

Dispersal typeanimal

Flowering timeyynnnnnnyyyy

Life formshrub

Life spanperennial

Pollination syndromeinsect

Raunkiær life formphanerophyte

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formtree

Leaf compoundnesssimple

Leaf shapefalcate lanceolate

Woodinesswoody

Physiology & chemistry4

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)6.48 mm²/mg

Wood density460 mg/cm³

Other traits1

Plant support typefree-standing

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Angophora leiocarpa has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes4

GenBank sequences3

eDNA detections2

The DNA barcodea real sequence read deposited for this species

ITSAF390447.1 ↗622 bp

ACGT

CATTGTCGAATCCTGCCCAGCAGAACGACCAGAGAATCGGTATAAAACTCAATGGGGACGGCGAGCTCCGCTGGCTGTCCCCCGACGTCG …

Angophora leiocarpa 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, internal transcribed spacer 2, and 26S ribosomal RNA gene, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★ITS1★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type3 206 records

Wild obs. + sensor1 005

Museum / vouchered484

Cultivated / captive4

Other1 713

Origin

Native124

Range

Area of Occupancy AOO6 352 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 775≤1 km 28≤10 km 10>10 km 82

895 georeferenced · 110 without coordinates

Open the mapobservation + sensor1 005

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy43% within 1 km

≤100 m 62≤1 km 111≤10 km 151>10 km 75

399 georeferenced · 85 without coordinates

Open the institutions mapphysical evidence484

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 2≤1 km 1

3 georeferenced · 1 without coordinates

Open the mapnot free-living4

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	145
Mount Annan, AU	124
Canberra, AU	81
Armidale, AU	64
Museo Entomologico de Leonlocation not on record	32
La Trobe Universitylocation not on record	18
Parkville, AU	7
Smithfield, AU	4
Adelaide, AU	3
James Cook Townsvillelocation not on record	2
NSW Dept of Planning, Industry and Environmentlocation not on record	1
Kensington, AU	1

12 institutions · 482 of 484 vouchered records shown · 2 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Angophora leiocarpa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Angophora leiocarpa

At a glance

Sources9 archives

Size & morphology15

Life cycle & reproduction9

Diet & foraging1

Habitat & environment10

Physiology & chemistry4

Other traits1

At a glance

Record type3 206 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions8 of 12 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Record type3 206 records