Angophora floribunda

(Sm.) Sweet · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Myrtaceae/Angophora

At a glance

Occurrence records30 805

Data sources11

Biological traits44

DNA specimens7

eDNA detections7

Sources11 archives

Databases and archives Angophora floribunda's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility30 805 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources44 traits

Chemical compositionLOTUS1 compounds

Occurrence & distributionGBIF30 805 records

Environmental DNA1 datasets · 0 countries7 detections

DNA & barcodingBOLD · NCBI7 specimens

Genome at a glanceCCDB · GoaT · NCBI≈388 Mbp

01Narrative

Angophora floribunda, appelé communément angophore polyflore, est une espèce de plantes à fleurs du genre Angophora et de la famille des Myrtaceae. C'est un arbre originaire d'Australie.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTAusTraitsTRY

Size & morphology17

Fruit length8.5 mm

Fruit width9 mm

Leaf length120 mm

Leaf length max90 mm

Leaf mass230 mg

Leaf mass per area112 g/m2

Leaf size1 982 mm²

Leaf width30 mm

Leaf width max35 mm

Petiole length1 cm

Plant height18 m

⚠ sources differ — GIFT: 18 m · AusTraits: 30 m · TRY: 20 m

Plant height max30 m

Plant height min15 m

Seed length6.25 mm

Seed mass13.6 mg

⚠ sources differ — TRY: 13.6 mg · AusTraits: 0.007 mg · GIFT: 13.56 mg

Seed mass max22.2 mg

Seed mass min6.65 mg

Life cycle & reproduction12

Deciduousnessevergreen

Dispersal typeself

Flowering timeyynnnnnnyyyy

Life formshrub or tree

Life spanperennial

Lifespan years100 years

Pollination modebiotic

Pollination syndromeinsect

Raunkiær life formphanerophyte

Reproductive maturity5 years

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formtree

Leaf compoundnesssimple

Leaf shapefalcate narrowly_lanceolate ovate

Woodinesswoody

Physiology & chemistry4

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)9.39 mm²/mg

Wood density725 mg/cm³

03Chemical composition1 compounds

Compounds documented for Angophora floribunda across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Flavones1

Documented compounds1 total

Tissue Source Quantified only

Compound	Class	Amount	Source
4'-Methylgenkwanin		present	LOTUS

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Angophora floribunda has left across the world's sequence archives.

At a glance

DNA specimens7

Marker genes4

GenBank sequences10

eDNA detections7

The DNA barcodea real sequence read deposited for this species

ITSMW139140.1 ↗309 bp

ACGT

CGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGTCATTTGGCGGAGGGCACGTTTGCCTGGGTGTCACACATGGCGTTGCCCC …

Angophora floribunda isolate Ang-flo-seq1 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL2★ITS5★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT · NCBI

The complete instruction manual Angophora floribunda carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈388 206 676 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Angophora floribunda0.39 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidydiploid inferred

Chromosome records22–222n range22median22mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 222×CCDB · book-fedorov · CCDB · book-atlas-flowering-plants

CCDB · book-fedorov — Smith-White 1942

CCDB · book-atlas-flowering-plants

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

08Occurrence & distribution

Record type30 805 records

Wild obs. + sensor29 357

Museum / vouchered961

Cultivated / captive4

Other483

Origin

Native288

Introduced15

Range

Area of Occupancy AOO30 588 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy99% within 1 km

≤100 m 27 638≤1 km 1 278≤10 km 179>10 km 37

29 132 georeferenced · 225 without coordinates

Open the mapobservation + sensor29 357

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy42% within 1 km

≤100 m 166≤1 km 159≤10 km 356>10 km 98

779 georeferenced · 182 without coordinates

Open the institutions mapphysical evidence961

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 3≤1 km 1

4 georeferenced

Open the mapnot free-living4

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions17 of 25 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mount Annan, AU	287
Canberra, AU	196
Brisbane, AU	113
Museo Entomologico de Leonlocation not on record	90
Armidale, AU	65
La Trobe Universitylocation not on record	44
Parkville, AU	42
NSW Dept of Planning, Industry and Environmentlocation not on record	25
Batemans Bay, AU	15
Smithfield, AU	14
Adelaide, AU	12
Kew, GB	9
Wollongong, AU	6
Hobart, AU	6
Rotorua, NZ	5
James Cook Townsvillelocation not on record	4
Canadian Department of Agriculturelocation not on record	4
Auckland, NZ	3
Stockholm, SE	3
John T. Waterhouse Herbariumlocation not on record	2
Palmerston, AU	2
Honolulu, US	1
University of Stellenboschlocation not on record	1
NSW Office of Environment and Heritagelocation not on record	1
Wuzhou, CN	1

25 institutions · 951 of 961 vouchered records shown · 10 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA7 detections

Where the DNA of Angophora floribunda was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Angophora floribunda

At a glance

Sources11 archives

Size & morphology17

Life cycle & reproduction12

Diet & foraging1

Habitat & environment10

Physiology & chemistry4

Compound class profile1 class

Documented compounds1 total

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Sequencing statusassembly quality — how far to trust these numbers

Record type30 805 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions17 of 25 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Record type30 805 records