Angophora costata

(Gaertn.) Britton · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Myrtaceae/Angophora

At a glance

Occurrence records13 811

Data sources11

Biological traits49

DNA specimens10

eDNA detections10

Sources11 archives

Databases and archives Angophora costata's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility13 811 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources49 traits

Chemical compositionLOTUS4 compounds

Occurrence & distributionGBIF13 811 records

Environmental DNA1 datasets · 0 countries10 detections

DNA & barcodingBOLD · NCBI10 specimens

Genome at a glanceCCDB2n = 22

01Narrative

Angophora costata est une espèce de plantes à fleurs de la famille des Myrtaceae. C'est un arbre forestier commun de l'est de l'Australie. Il est connu sous différents noms, notamment pommier à écorce lisse, gomme rose, pommier rose et gommier rouge de Sydney.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTAusTraitsTRY

Size & morphology17

Fruit length18 mm

Fruit width17 mm

Leaf length11.95 mm

Leaf length max125 mm

Leaf mass367 mg

Leaf mass per area193 g/m2

Leaf size2 456 mm²

⚠ sources differ — TRY: 2 456 mm² · AusTraits: 1 813 mm²

Leaf width2.55 mm

Leaf width max65 mm

Petiole length1.75 cm

Plant height20 m

⚠ sources differ — GIFT: 20 m · AusTraits: 25 m · TRY: 25.16 m

Plant height max30 m

Plant height min15 m

Seed length7 mm

Seed mass16.13 mg

⚠ sources differ — TRY: 16.13 mg · AusTraits: 0.014 mg · GIFT: 16.06 mg

Seed mass max20.54 mg

Seed mass min10.1 mg

Life cycle & reproduction12

Deciduousnessevergreen

Dispersal typeself

⚠ sources differ — AusTraits: barochory · GIFT: unspecialized

Flowering timennnnnnnnnyyy

Life formshrub or tree

Life spanperennial

Lifespan years100 years

Pollination modebiotic

Pollination syndromeinsect

Raunkiær life formphanerophyte

Reproductive maturity5 years

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment11

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formtree

Habitat GIFTLowland

Leaf compoundnesssimple

Leaf shapefalcate lanceolate

Woodinesswoody

Physiology & chemistry8

Leaf c547 mg/g

Leaf dry-matter content (LDMC)900 mg/g

Leaf n11.81 mg/g

Leaf p0.54 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)5.39 mm²/mg

Wood density729 mg/cm³

03Chemical composition4 compounds

Compounds documented for Angophora costata across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Flavanones3

Flavones1

Documented compounds4 total

Tissue Source Quantified only

Compound	Amount	Source
(-)-Farrerol	present	LOTUS
(2R)-5,7-dihydroxy-2-(4-hydroxyphenyl)-6,8-dimethyl-2,3-dihydrochromen-4-one	present	LOTUS
(2S)-2,3-Dihydro-5-hydroxy-2-(4-hydroxyphenyl)-7-methoxy-6,8-dimethyl-4H-1-benzopyran-4-one	present	LOTUS
4'-Methylgenkwanin	present	LOTUS

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Angophora costata has left across the world's sequence archives.

At a glance

DNA specimens10

Marker genes3

GenBank sequences10

eDNA detections10

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMW139138.1 ↗309 bp

ACGT

CGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGTCATTTGGCGGAGGGCACGTTTGCCTGGGTGTCACACATGGCGTTGCCCC …

Angophora costata isolate Ang-cos-seq2 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4★rbcL2★ITS4

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Angophora costata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidydiploid inferred

Chromosome records22–222n range22median22mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 222×CCDB · book-fedorov · CCDB · book-atlas-flowering-plants

CCDB · book-fedorov — Smith-White 1942

CCDB · book-atlas-flowering-plants

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type13 811 records

Wild obs. + sensor13 563

Museum / vouchered196

Cultivated / captive6

Other46

Origin

Native36

Introduced19

Range

Area of Occupancy AOO10 288 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy98% within 1 km

≤100 m 11 736≤1 km 1 163≤10 km 219>10 km 39

13 157 georeferenced · 406 without coordinates

Open the mapobservation + sensor13 563

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy68% within 1 km

≤100 m 37≤1 km 26≤10 km 20>10 km 9

92 georeferenced · 104 without coordinates

Open the institutions mapphysical evidence196

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 3≤1 km 2

5 georeferenced · 1 without coordinates

Open the mapnot free-living6

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions22 of 28 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mount Annan, AU	36
Armidale, AU	25
Rotorua, NZ	21
Adelaide, AU	21
Parkville, AU	14
Auckland, NZ	13
NSW Dept of Planning, Industry and Environmentlocation not on record	10
Museo Entomologico de Leonlocation not on record	9
Canberra, AU	6
Batemans Bay, AU	5
Brisbane, AU	4
Miami, US	4
Kew, GB	4
Wollongong, AU	3
Cape Town, ZA	2
Tampa, US	2
John T. Waterhouse Herbariumlocation not on record	2
La Trobe Universitylocation not on record	2
Wellington, NZ	2
Kensington, AU	1
Christchurch, NZ	1
University of Stellenboschlocation not on record	1
EL PASO, US	1
Bronx, US	1
Durban, ZA	1
Canadian Department of Agriculturelocation not on record	1
San Diego, US	1
Pretoria, ZA	1

28 institutions · 194 of 196 vouchered records shown · 2 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA10 detections

Where the DNA of Angophora costata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found10

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 10 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Angophora costata

At a glance

Sources11 archives

Size & morphology17

Life cycle & reproduction12

Diet & foraging1

Habitat & environment11

Physiology & chemistry8

Compound class profile2 classes

Documented compounds4 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type13 811 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions22 of 28 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Record type13 811 records