Angophora bakeri

E.C.Hall · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Myrtaceae/Angophora

At a glance

Occurrence records2 952

Data sources5

Biological traits34

DNA specimens2

eDNA detections2

Sources5 archives

Databases and archives Angophora bakeri's data was compiled from.

GBIFGlobal Biodiversity Information Facility2 952 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements4 literature sources34 traits

Occurrence & distributionGBIF2 952 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology11

Fruit length9 mm

Fruit width9 mm

Leaf length80 mm

Leaf length max75 mm

Leaf mass per area170 g/m2

Leaf width7.5 mm

Leaf width max13 mm

Petiole length0.55 cm

Plant height12.5 m

Plant height max10 m

Seed mass7.91 mg

⚠ sources differ — TRY: 7.91 mg · AusTraits: 0.007 mg

Life cycle & reproduction10

Deciduousnessevergreen

Dispersal typeanimal

Flowering timeynnnnnnnnnny

Life formshrub

Life span>100

⚠ sources differ — TRY: >100 · AusTraits: perennial · GIFT: perennial

Lifespan years100 years

Raunkiær life formphanerophyte

Reproductive maturity1 years

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formtree

Leaf compoundnesssimple

Leaf shapelanceolate

Woodinesswoody

Physiology & chemistry2

Photosynthetic pathwayC3

Wood density589 mg/cm³

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Angophora bakeri has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences4

eDNA detections2

The DNA barcodea real sequence read deposited for this species

ITSDQ993149.1 ↗542 bp

ACGT

CCGGTATAAAACTCGATGGGGACAGCGAGCTTCACTGGCCGTCCTTCGACGCCAGGGATCGCGTGGGTGCCCTCGGCAGCACAACGAACC …

Angophora bakeri isolate 32 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS3

plant barcodefungal barcode

08Occurrence & distribution

Record type2 952 records

Wild obs. + sensor2 641

Museum / vouchered307

Cultivated / captive4

Origin

Native110

Range

Area of Occupancy AOO3 476 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy97% within 1 km

≤100 m 2 155≤1 km 361≤10 km 57>10 km 9

2 582 georeferenced · 59 without coordinates

Open the mapobservation + sensor2 641

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy69% within 1 km

≤100 m 16≤1 km 179≤10 km 74>10 km 12

281 georeferenced · 26 without coordinates

Open the institutions mapphysical evidence307

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 1≤1 km 2

3 georeferenced · 1 without coordinates

Open the mapnot free-living4

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mount Annan, AU	110
Canberra, AU	63
Armidale, AU	31
Museo Entomologico de Leonlocation not on record	29
La Trobe Universitylocation not on record	19
Brisbane, AU	18
Adelaide, AU	10
Parkville, AU	9
Wollongong, AU	5
John T. Waterhouse Herbariumlocation not on record	5
NSW Dept of Planning, Industry and Environmentlocation not on record	4
Kew, GB	4

12 institutions · 307 of 307 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Angophora bakeri was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Angophora bakeri

At a glance

Sources5 archives

Size & morphology11

Life cycle & reproduction10

Diet & foraging1

Habitat & environment10

Physiology & chemistry2

At a glance

Record type2 952 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions8 of 12 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Record type2 952 records