Angiopolybia pallens

(Lepeletier, 1836) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Vespidae/Angiopolybia

At a glance

Occurrence records352

Data sources7

Biological traits0

DNA specimens201

eDNA detections153

Sources7 archives

Databases and archives Angiopolybia pallens's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility352 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI153 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics201 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF352 records

Environmental DNA1 datasets · 2 countries153 detections

DNA & barcodingBOLD201 specimens

01Narrative

Angiopolybia pallens is a species of social wasp predominantly found in South America. The wasp is generally seen in Brazilian rainforests. This species was discovered by Lepeletier in 1836. It typically feeds on nectar and carrion. In fact much of its feeding behavior and impact on humans is centered on feeding on animal carcasses. The wasp species displays a caste differentiation that can be seen by difference in ovarian development. Additionally they have a unique colony establishment procedure. It begins with a few individuals from the nest leaving to find a good site and then the rest of the colony follows using specific communication signals that are further discussed in this article.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding201 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Angiopolybia pallens has left across the world's sequence archives.

At a glance

DNA specimens201

BINs7

Marker genes1

eDNA detections153

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P416 bp consensus197 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 90% of positions are identical in every specimen.

Where individuals differ — all 43 variable positions, in barcode order

18Avariable

63Tvariable

64Tvariable

69Cmostly conserved

102Tvariable

108Tvariable

114Avariable

117Tmostly conserved

120Amostly conserved

138Tvariable

141Tvariable

150Tmostly conserved

153Cvariable

162Tmostly conserved

171Tmostly conserved

183Tmostly conserved

186Cvariable

192Cvariable

198Tmostly conserved

201Tvariable

213Tmostly conserved

214Gvariable

216Avariable

222Tmostly conserved

234Amostly conserved

249Avariable

270Tmostly conserved

276Tvariable

277Cvariable

278Avariable

280Tvariable

330Tvariable

331Tmostly conserved

346Tmostly conserved

360Tmostly conserved

363Amostly conserved

369Tvariable

379Tvariable

381Avariable

384Tmostly conserved

399Cvariable

402Cmostly conserved

414Tvariable

CCATTAATATTAGGAGCACCTGATATAGCTTTCCCTCGTATAAATAATATAAGTTTTTGACTTTTACCCCCATCATTATTTTTATTAATT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens. Showing the 34 commonest of 71 variants.

Diversity (π)4.4%

Haplotypes71

BINs7

Most divergent pair8.9%

OtherS.AmericaN.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Polybia simillimasame family13.2%Asteloeca trailisame family13.7%Polistes gigassame family13.7%Polybia bistriatasame family14.4%Polistes biglumissame family14.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type352 records

Wild obs. + sensor36

Museum / vouchered312

Other4

Range

Area of Occupancy AOO216 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy78% within 1 km

≤100 m 8≤1 km 10>10 km 5

23 georeferenced · 13 without coordinates

Open the mapobservation + sensor36

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy10% within 1 km

≤100 m 3≤1 km 22≤10 km 225

250 georeferenced · 62 without coordinates

Open the institutions mapphysical evidence312

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
The University of the West Indies, Trinidad and Tobagolocation not on record	119
Natural History Museum Rotterdamlocation not on record	92
Provincia di Livornolocation not on record	22
Philadelphia, US	16
Centre for Biodiversity Genomicslocation not on record	16
	12
College Station, US	9
Washington, US	8
OSUClocation not on record	6
Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record	5
Universidad del Atlántico (UniAtlantico)location not on record	3
Smithsonian Institution, National Museum of Natural Historylocation not on record	2
Champaign, US	1

13 institutions · 311 of 312 vouchered records shown · 1 without an institution code

09Environmental DNA153 detections

Where the DNA of Angiopolybia pallens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found153

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 153 detections have coordinates

Open the map2 countries0

1. Forest & Woodland|1.6. Subtropical/Tropic…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.7 °C 22.4–23.5

Seasonal swing summer↔winter2.90 °C

Max temp (day)25.8 °C 25.6–27.1

Min temp (night)19.8 °C 18.9–20.8

Precipitation322 mm/mo 238–487

Air humidity68.4 % 66.6–71.8

Moisture balance207 mm/mo 109–360

Vapour deficit877 Pa 814–901

Wind speed0.5 m/s 0.5–2.10

Cloud cover61.8 % 23.3–67.8

CHELSA 1981–2010, ~9 km grid, at location & month of 22 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)