Angianthus preissianus

(Steetz) Benth. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Angianthus

At a glance

Occurrence records1 043

Data sources7

Biological traits31

DNA specimens2

eDNA detections2

Sources7 archives

Databases and archives Angianthus preissianus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 043 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources31 traits

Occurrence & distributionGBIF1 043 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceGoaTgenome

01Narrative

Angianthus preissianus là một loài thực vật có hoa trong họ Cúc. Loài này được (Steetz) Benth. mô tả khoa học đầu tiên năm 1867.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAusTraitsTRYGIFT

Size & morphology12

Fruit length0.65 mm

Fruit width0.3 mm

Leaf length7.5 mm

Leaf width1.5 mm

Plant height0.115 m

Plant height max0.16 m

Plant height min0.03 m

Seed length0.7 mm

Seed mass0.041 mg

⚠ sources differ — TRY: 0.041 mg · AusTraits: 0.044 mg · GIFT: 0.04 mg

Seed mass max0.04 mg

Seed mass min0.04 mg

Seed width0.3 mm

Life cycle & reproduction7

Dispersal typewind

Flowering timennnnnnnnnyyy

Life spanannual

Pollination syndromeinsect

Raunkiær life formtherophyte

Resprouting capacityfire_killed

Sex typehermaphrodite+monoecious

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climberself-supporting

Fruit fleshinessdry

Fruit typeachene

Growth formherb

Leaf compoundnesssimple

Leaf shapelinear narrowly_elliptical terete

Woodinessnon-woody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Angianthus preissianus has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences2

eDNA detections2

The DNA barcodea real sequence read deposited for this species

ITSJX564699.1 ↗713 bp

ACGT

CAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAACCCTGCAACGCAGAACGACCCGTGAACATGTAACAACAACCGGGCAAC …

Angianthus preissianus isolate ASL466 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS1

plant barcodefungal barcode

06Genome at a glanceGoaT

The complete instruction manual Angianthus preissianus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Ploidydiploid inferred

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 043 records

Wild obs. + sensor483

Museum / vouchered560

Origin

Native221

Range

Area of Occupancy AOO2 808 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy73% within 1 km

≤100 m 221≤1 km 120≤10 km 120>10 km 6

467 georeferenced · 16 without coordinates

Open the mapobservation + sensor483

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy51% within 1 km

≤100 m 107≤1 km 152≤10 km 223>10 km 28

510 georeferenced · 50 without coordinates

Open the institutions mapphysical evidence560

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Adelaide, AU	195
Museo Entomologico de Leonlocation not on record	107
Kensington, AU	87
Hobart, AU	61
Canberra, AU	35
Mount Annan, AU	13
QVMAGlocation not on record	9
Brisbane, AU	6
Parkville, AU	5
GB	2
EL PASO, US	1
Taipei, TW	1
Kew, GB	1
Christchurch, NZ	1
JBRJlocation not on record	1
Palmerston, AU	1
LDlocation not on record	1

17 institutions · 527 of 560 vouchered records shown · 33 without an institution code

09Environmental DNA2 detections

Where the DNA of Angianthus preissianus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Angianthus preissianus

At a glance

Sources7 archives

Size & morphology12

Life cycle & reproduction7

Diet & foraging1

Habitat & environment8

Physiology & chemistry2

Other traits1

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 043 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions13 of 17 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type1 043 records