Angelica tomentosa

S.Watson · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Apiales/Apiaceae/Angelica

At a glance

Occurrence records472

Data sources9

Biological traits12

DNA specimens3

eDNA detections1

Sources9 archives

Databases and archives Angelica tomentosa's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility472 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources12 traits

Occurrence & distributionGBIF472 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI3 specimens

01Narrative

Angelica tomentosa is a species of angelica known as woolly angelica. It is native to the coastal mountain ranges of California and southern Oregon, where it grows in wooded areas. This is a taprooted perennial herb producing an erect, hollow stem to heights generally between 1 and 2 meters. The leaves may be nearly a meter long but are actually made up of many leaflike leaflets, each up to 12 centimeters long and lance-shaped to oval and sometimes toothed. The inflorescence is a compound umbel of up to 60 long rays each bearing clusters of whitish or yellowish flowers.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass8.63 mg

Seed mass max8.63 mg

Seed mass min8.63 mg

Life cycle & reproduction2

Life formperennial

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Angelica tomentosa has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes4

GenBank sequences3

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMT735447.1 ↗599 bpUSA · 1957

ACGT

TCGAATCCTGCAATAGCAGAATGACCCGCTAACACGTTAACAATTTGGGCGAGCGTCGGGGGGCCTCGGTCTCCTGACTGCGAATCCCTG …

Angelica tomentosa voucher R. Bacigalupi &L.R. Heckard 6057 (ILL) internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcLa★ITS3★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type472 records

Wild obs. + sensor197

Museum / vouchered273

Fossil2

Range

Area of Occupancy AOO1 004 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 124≤1 km 15≤10 km 3>10 km 4

146 georeferenced · 51 without coordinates

Open the mapobservation + sensor197

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy69% within 1 km

≤100 m 10≤1 km 117≤10 km 53>10 km 4

184 georeferenced · 89 without coordinates

Open the institutions mapphysical evidence273

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Arcata, US	60
Davis, US	34
Claremont, US	27
Riverside, US	18
Angwin, US	18
San Diego, US	15
Canadian Department of Agriculturelocation not on record	14
Santa Barbara, US	10
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	7
Santa Cruz, US	6
Irvine, US	4
STNFlocation not on record	4
Corvallis, US	4
San Luis Obispo, US	3
San Jose, US	2
Severin-McDaniel Insect Collectionlocation not on record	2
Bronx, US	1
US	1
San Diego Natural History Museum, Herbariumlocation not on record	1
CASlocation not on record	1

20 institutions · 232 of 273 vouchered records shown · 41 without an institution code

09Environmental DNA1 detections

Where the DNA of Angelica tomentosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

Woodland burnt in 2003 Cedar fire; Symphoric…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median27.1 °C 27.1–27.1

Seasonal swing summer↔winter16.8 °C

Max temp (day)35.6 °C

Min temp (night)19.4 °C

Precipitation7.80 mm/mo

Air humidity47.0 %

Moisture balance-220 mm/mo

Vapour deficit1,898 Pa

Wind speed3.50 m/s

Cloud cover15.0 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)