Angelica sylvestris
speciesAt a glance
Occurrence records748 529
Data sources16
Biological traits43
DNA specimens40
eDNA detections20
Sources16 archives
Databases and archives Angelica sylvestris's data was compiled from.
WikipediaWikimedia Foundation12 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility748 529 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI20 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics40 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
WikidataWikimedia Foundationstructured facts↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources43 traits
Chemical compositionLOTUS · NPASS7 compounds
Occurrence & distributionGBIF748 529 records
Environmental DNA1 datasets · 7 countries20 detections
DNA & barcodingBOLD · NCBI40 specimens
Genome at a glanceCCDB · GoaT2n = 22
01Narrative
Angelica sylvestris or wild angelica is a species of flowering plant, native to Europe and central Asia. An annual or short-lived perennial growing to a maximum of 2.5 m, it has erect purplish stems and rounded umbels of minuscule white or pale pink flowers in late summer.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDATRYWCVP
Size & morphology10
Leaf mass1 531 mg
Leaf size30 633 mm²
⚠ sources differ — TRY: 30 633 mm² · LEDA: 40 902 mm² · GIFT: 40 902 mm²
Plant height0.783 m
⚠ sources differ — GIFT: 0.783 m · LEDA: 0.9 m · TRY: 0.834 m
Plant height generative1.05 m
Plant height max2 m
Plant height min0.5 m
Seed length4.57 mm
Seed mass1.71 mg
⚠ sources differ — TRY: 1.71 mg · LEDA: 2.96 mg · GIFT: 2.7 mg
Seed mass max7.57 mg
Seed mass min1.15 mg
Life cycle & reproduction13
Deciduousnessaestival
⚠ sources differ — TRY: aestival · GIFT: deciduous
Dispersal typewater
Flowering endAug
Flowering startJul
Life formbiennial or perennial
Life span3-5
⚠ sources differ — TRY: 3-5 · LEDA: strict monocarpic bi-annuals and poly-annuals · GIFT: perennial
Lifespan years2 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formhemicryptophyte
Reproduction asexualabsent
Seed number4 596
Self fertilizationpresent
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment8
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Epiphyteterrestrial
Growth formherb
Habitat GIFTforest, forest edges, meadows: wet, swamps
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry8
Leaf C:N ratio16.65 g/g
Leaf c430 mg/g
Leaf dry-matter content (LDMC)229 mg/g
Leaf n28.44 mg/g
Leaf p3.82 mg/g
Photosynthetic pathwayC3
Seed longevity index0
Specific leaf area (SLA)27.15 mm²/mg
Other traits2
Diaspore typeone-seeded generative dispersule
Monocarpymonocarp
03Chemical composition7 compounds
Compounds documented for Angelica sylvestris across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Labdane diterpenoids $ Norlabdane diterpenoids2
Labdane diterpenoids1
Norlabdane diterpenoids1
Aromadendrane sesquiterpenoids1
Furocoumarins $ Simple coumarins1
Documented compounds7 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (1aS,4S,4aS,7S,7aR,7bR)-1,1,4,7-tetramethyl-2,3,4a,5,6,7,7a,7b-octahydro-1aH-cyclopropa[e]azulen-4-ol | present | LOTUS | |
| (1S,4aR,5S,8aR)-5-[2-(furan-3-yl)-2-oxoethyl]-1,4a-dimethyl-6-methylidene-3,4,5,7,8,8a-hexahydro-2H-naphthalene-1-carboxylic acid | present | NPASS | |
| (1S,4aR,5S,8aS)-5-[(3S)-4-carboxy-3-methylbutyl]-1,4a-dimethyl-6-methylidene-3,4,5,7,8,8a-hexahydro-2H-naphthalene-1-carboxylic acid | present | NPASS | |
| Isooxypeucedanin | present | NPASS | |
| Junicedric acid | present | NPASS | |
| KPLBOWKEQXYXSD-UHFFFAOYSA-N | present | NPASS | |
| Lambertiainc Acid | present | NPASS |
05DNA & barcoding40 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Angelica sylvestris has left across the world's sequence archives.
At a glance
DNA specimens40
Marker genes7
GenBank sequences10
eDNA detections20
Countries7
The DNA barcodea real sequence read deposited for this species
TGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACTAGGCTGAGGGCACGCCTGCCTGGGTGTCACGCATC …
Angelica sylvestris voucher EDNA21-0061430 internal transcribed spacer region, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK★rbcL3★rbcLa★ITS7★ITS1★ITS2trnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceCCDB · GoaT
The complete instruction manual Angelica sylvestris carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 22 n = 11
Ploidydiploid inferred
Chromosome records22–262n range22median22mode53records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 2250×GoaT · DTOL Flowering Plants Estimates Kew · CCDB · slov-fl · CCDB · iapt +12
GoaT · DTOL Flowering Plants Estimates Kew
CCDB · slov-fl — Májovský J. et al., 1974a: Index of chromosome numbers of Slovakian flora (Part 3). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 22: 1-20.
CCDB · iapt — IAPT/IOPB Chromosome Data 13
CCDB · brit-fl — Hollingsworth, P.M., Gornall, R.J., Bailey, J.P. Watsonia 19: 134-137 (1992)
CCDB · iber-fl — Estudio biosistemtico de las especies del gnero Angelica L. de la pennsula Ibrica. Madrid. Gutierrez Bustillo, A. M.*(1982).
CCDB · iber-fl — Revisin del gnero Angelica (Umbelliferae) en la pennsula Ibrica. Gutierrez Bustillo, A. M.Lazaroa3: 137-161(1981).
CCDB · iber-fl — Contribuiao para o conhecimento citotaxonmico das spermatophyta de Portugal. Queirs, M.Anurio Soc. Brot.38: 293(1972).
CCDB · iber-fl — Contribuiao para o conhecimento citotaxonmico das spermatophyta de Portugal. VII. Umbelliferae, supl. 1. Queirs, M.Bol. Soc. Brot. ser. 248: 171-186(1974).
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=3300
CCDB · fl-europaea — Polya, 1950
CCDB · poland — Frey L., Mizianty M. and Mirek Z. 1981. Chromosome numbers of Polish vascular plants. Fragm. Flor. Geobot. 27, 581-590.
CCDB · poland — Pogan E., Izmai?ow R. et al. 1983. Further studies in chromosome numbers of Polish Angiosperms. Part XVII. Acta Biol. Cracov. Ser. Bot. 25, 57-77.
CCDB · ipcn-api-dl — Arohonka, T. 1982. Chromosome counts of vascular plants of the island Seili in Nauvo, southwestern Finland. Turun Yliopiston Julkaisuja, Sar. A 2, Biol.-Geogr. 3: 1–12.
CCDB · ipcn-api-dl — Mizianty, M., L. Frey & Z. Mirek. 1981. Contribution to the knowledge of the chromosome numbers of Polish vascular plants. Fragm. Florist. Geobot. 27: 19–30.
CCDB · ipcn-api-dl — Pogan, E. 1983. Further studies in chromosome numbers of Polish angiosperms. Part XVII. Acta Biol. Cracov., Ser. Bot. 25: 57–77.
CCDB · ipcn-api-dl — Dmitrieva, S. A. & V. I. Parfenov. 1983. Khromosomnye chisla nekotorykh vidov flory Belorussii. Izv. Akad. Nauk Belorussk. SSR, Ser. Biol. Nauk 2: 7–12.
CCDB · ipcn-api-dl — Rostovtseva, T. S. 1982. The chromosome numbers of some species of the family Apiaceae. III. Bot. Zhurn. SSSR 67 (2): 206–210. (In Russian).
CCDB · ipcn-api-dl — Vassiljeva, M. G. & M. G. Pimenov. 1991. Karyotaxonomical analysis in the genus Angelica (Umbelliferae). Pl. Syst. Evol. 177: 117–138.
CCDB · ipcn-api-dl — Hollingsworth, P. M., R. J. Gornall & J. P. Bailey. 1992. Contribution to a cytological catalogue of the British and Irish flora, 2. Watsonia 19: 134–137.
CCDB · ipcn-api-dl — Mĕsíček, J. 1992. In J. M|3esí|3ccek & V. Jav@0urková-Jarolímová, List of Chromosome Numbers of the Czech Vascular Plants. Academia, Praha.
CCDB · ipcn-api-dl — Albers, F. & W. Pröbsting. 1998. In R. Wisskirchen & H. Haeupler, Standardliste der Farn- und Blütenpflanzen Deutschlands. Bundesamt für Naturschutz & Verlag Eugen Ulmer, Stuttgart.
CCDB · ipcn-api-dl — Lövkvist, B. & U. M. Hultgård. 1999. Chromosome numbers in south Swedish vascular plants. Opera Bot. 137: 1–42.
CCDB · ipcn-api-dl — Rostovtseva, T. S. 1979. Chromosome numbers of some species of the family Apiaceae Lindl. II. Bot. Zhurn. 64 (2): 227–232.
CCDB · ipcn-api-dl — Strid, A. & R. Franzen. 1981. In Chromosome number reports LXXIII. Taxon 30: 829–842.
CCDB · ipcn-api-dl — PEEV, D. 1977. In IOPB chromosome number reports LV. Taxon 26: 107–109.
CCDB · ipcn-api-dl — Queiros, M. 1974a. Contribucao para o conhecimento citotaxonomico das Spermatophyta de Portugal. VII. Umbelliferae, Supl. 1. Bol. Soc. Brot., sér. 2 48: 171–186.
CCDB · ipcn-api-dl — Queiros, M. 1978. Numeros cromosomicos para a flora Portuguesa 1-15. Bol. Soc. Brot., sér. 2 52: 69–77.
CCDB · ipcn-api-dl — Krasnikov, A. A. & D. N. Schaulo. 1986. Chromosome numbers of some representatives of the families Apiaceae and Ranunculaceae from the south of Siberia. Bot. Žhurn. (Moscow & Leningrad) 71: 116–117.
CCDB · ipcn-api-dl — Pan, Z. h., T. d. Zhang, X. m. Yao & N. Sheng. 1994. A study on karyotypes and geographical distribution of Angelica and related genera (Umbelliferae) in China. Acta Phytotax. Sin. 32(5): 419–424.
CCDB · ipcn-api-dl — Mizianti, M., L. Frey & Z. Mirek. 1981. Contribution to the knowledge of the chromosome numbers of Polish vascular plants. Fragm. Florist. Geobot. 27: 19–29.
CCDB · book-ipcn67-71 — CAUWET, A. - M. 1968. Contriburion a l'etude caryologique des Ombelliferes de la partie orientale des Pyrenees. Naturalia Monspel. Ser. Bot. 19: 5-27.
CCDB · book-ipcn67-71 — GADELLA, Th. W. J., & E. KLIPHUIS. 1966.' Chromosome numbers of flowering plants in the Netherlands II. Proc. Roy. Neth. Acad. Sci. Ser. C. 69: 541-556.
CCDB · book-ipcn73-74 — MAJOVSKY, J., ET AL. 1974. Index of chromosome numbers of Slovakian flora. (Part 3). Acta Fac. Rerum Nat. Univ. Comenianae Bot. 22: 1-20.
CCDB · book-ipcn73-74 — QUEIROS, M. 1972. Contribuicao ao conhecimento citotaxonomico das Spermatophyta de Portugal. VII Umbelliferae. Anuario Soc. Brot. 38: 293-314.
CCDB · book-atlas-flowering-plants — Eur., N. & S.W.
CCDB · Cave1956 — Love & Love b
CCDB · Cave1963 — Sorsa 1962, 1963c
CCDB · CromoCat 2015 — Cauwet, A. M. (1968). Contribution a l'étude caryologique des Ombellifères de la partie orientale des Ptrénées. Naturalia Monspel., Sér. Bot. 19: 5-27.
CCDB · CromoCat 2015 — Chepinoga, V. V., Gnutikov, A. A., Moritz, R. S., Lubogoschinsky, P. I. & Sergeyeva, A. S. (2012). IAPT/IOPB Chromosome Data 13 Taxon 61:892-894
CCDB · CromoCat 2015 — Gutierrez Bustillo, A. M. (1981). Revisión del género Angelica (Umbelliferae) en la Península Ibérica. Lazaroa 3: 137-161.
+7 more references
2n 263×CCDB · iber-fl · CCDB · CromoCat 2015
CCDB · iber-fl — Estudio biosistemtico de las especies del gnero Angelica L. de la pennsula Ibrica. Madrid. Gutierrez Bustillo, A. M.*(1982).
CCDB · CromoCat 2015 — Gutierrez Bustillo, A. M. (1981). Revisión del género Angelica (Umbelliferae) en la Península Ibérica. Lazaroa 3: 137-161.
CCDB · CromoCat 2015 — Gutierrez Bustillo, A. M. (1982). Estudio biosistemático de las especies del género Angelica L. de la península Ibérica. Madrid
n 118×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · eflora +2
CCDB · ipcn-api-dl — Rostovtseva, T. S. 1982. The chromosome numbers of some species of the family Apiaceae. III. Bot. Zhurn. SSSR 67 (2): 206–210. (In Russian).
CCDB · ipcn-api-dl — Wetschnig, W. & G. H. Leute. 1991. Chromosomenzahlen Kärntner Gefässflanzen (Teil 2, Doldenblütler---Apiaceae = Umbelliferae). Linzer Biol. Beitr. 23: 457–481.
CCDB · ipcn-api-dl — Strid, A. & R. Franzen. 1981. In Chromosome number reports LXXIII. Taxon 30: 829–842.
CCDB · ipcn-api-dl — Rostovtseva, T. S. 1976. Chromosome numbers of some species of the family Apiaceae in South Siberia. Bot. Žhurn. (Moscow & Leningrad) 61(1): 93–99.
CCDB · book-ipcn67-71 — KORDYUM, E. L. 1967. Cyto-embryology of Umbellates. (In Russian). Naukova Dumka, Kiev, 1967, 128pp.
CCDB · eflora
CCDB · Cave1963 — Sorsa 1962, 1963c
CCDB · CromoCat 2015 — Wetschnig, W. & G. H. Leute. (1991). Chromosomenzahlen Kärntner Gefässflanzen (Teil 2, Doldenblütler---Apiaceae = Umbelliferae). Linzer Biol. Beitr. 23: 457-481.
n 01×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Chepinoga, V. V., Gnutikov, A. A., Moritz, R. S., Lubogoschinsky, P. I. & Sergeyeva, A. S. (2012). IAPT/IOPB Chromosome Data 13 Taxon 61:892-894
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
07Deep time~1.99 Ma lineage
How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.
At a glance
DNA clock origin1.99 Ma TimeTree
When this lineage existed
How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.
DNA clock origin
08Occurrence & distribution
Record type748 529 records
Wild obs. + sensor733 599
Museum / vouchered11 821
Cultivated / captive124
Other2 985
Origin
Native42 251
Introduced31
Range
Area of Occupancy AOO710 372 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy57% within 1 km
≤100 m 162 142≤1 km 176 792≤10 km 256 316>10 km 3 556
598 806 georeferenced · 134 793 without coordinates
Open the mapobservation + sensor733 599
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy28% within 1 km
≤100 m 738≤1 km 1 886≤10 km 6 280>10 km 362
9 266 georeferenced · 2 555 without coordinates
Open the institutions mapphysical evidence11 821
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 30>10 km 12
42 georeferenced · 82 without coordinates
Open the mapnot free-living124
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions71 of 154 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 5 841 |
| BFLlocation not on record | 501 |
| Moscow State Universitylocation not on record | 408 |
| LDlocation not on record | 372 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 371 |
| Salzburg, AT | 337 |
| Kuopio, FI | 252 |
| Turku, FI | 200 |
| Uppsala, SE | 199 |
| Olocation not on record | 193 |
| Trondheim, NO | 137 |
| Oulu, FI | 130 |
| MeiseBGlocation not on record | 128 |
| Oskarshamn, SE | 106 |
| SLU Artdatabankenlocation not on record | 105 |
| Garðabær, IS | 104 |
| Bergen, NO | 96 |
| Uniwersytet Warszawskilocation not on record | 91 |
| Jyväskylä, FI | 79 |
| Tartu, EE | 78 |
| TROMlocation not on record | 69 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 66 |
| Görlitz, DE | 56 |
| KMNlocation not on record | 53 |
| Bern, CH | 50 |
| Karlsruhe, DE | 48 |
| TUR-Alocation not on record | 48 |
| South Kensington, GB | 46 |
| Provincia di Livornolocation not on record | 37 |
| Barcelona, ES | 37 |
| BRNUlocation not on record | 34 |
| Tallinn, EE | 34 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 33 |
| DBF-NHMDlocation not on record | 31 |
| Uniwersytet Śląski w Katowicachlocation not on record | 30 |
| Vitoria, ES | 30 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 29 |
| BDBClocation not on record | 28 |
| MAlocation not on record | 28 |
| Mlocation not on record | 27 |
| 27 | |
| CJBGlocation not on record | 25 |
| Zürich, CH | 24 |
| CICYTEXlocation not on record | 21 |
| Porvoo, FI | 18 |
| BClocation not on record | 17 |
| Kandalaksha State Nature Reservelocation not on record | 17 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 14 |
| Salamanca, ES | 13 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 13 |
| ISAlocation not on record | 13 |
| Saint John, CA | 12 |
| Entomological Society of Latvialocation not on record | 12 |
| Université Lavallocation not on record | 12 |
| Porrentruy, CH | 11 |
| GZUlocation not on record | 10 |
| Natural History Museum Rotterdamlocation not on record | 10 |
| Adam Mickiewicz University in Poznańlocation not on record | 10 |
| Berlin, DE | 10 |
| Palacký University in Olomouclocation not on record | 9 |
| Helsinki, FI | 9 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 9 |
| Wlocation not on record | 8 |
| Edinburgh, GB | 7 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 7 |
| Rovaniemi, FI | 7 |
| Zürich, CH | 7 |
| Pamplona, ES | 6 |
| Paris, FR | 6 |
| Acadia Universitylocation not on record | 6 |
| Tilburg, NL | 6 |
| Uniwersytet Opolskilocation not on record | 5 |
| Sion, CH | 5 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 5 |
| inatura Erlebnis Naturschau GmbHlocation not on record | 5 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 5 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 5 |
| Bourges, FR | 5 |
| SZUlocation not on record | 5 |
| Glarus, CH | 5 |
| Museo Achille Folettolocation not on record | 5 |
| Podgorica, ME | 5 |
| Frankfurt am Main | 5 |
| Ivano-Frankove, UA | 5 |
| Philadelphia, US | 4 |
| H-Schuhwlocation not on record | 4 |
| Stockholm, SE | 4 |
| Memorial University of Newfoundlandlocation not on record | 4 |
| Tromso University Museumlocation not on record | 4 |
| UGentlocation not on record | 4 |
| SNSNMClocation not on record | 3 |
| Pamplona, ES | 3 |
| Québec, CA | 3 |
| BSBIlocation not on record | 3 |
| Xiamen, CN | 3 |
| Forssa, FI | 3 |
| Finnish Museum of Natural Historylocation not on record | 3 |
| Wellington, NZ | 3 |
| Badajoz, ES | 3 |
| Naturalis Biodiversity Centerlocation not on record | 3 |
| Montréal, CA | 3 |
| Granada, ES | 2 |
| Winterthur, CH | 2 |
| Tula State Universitylocation not on record | 2 |
| Christchurch, NZ | 2 |
| Prioksko-Terrasnyi Biosphere Reservelocation not on record | 2 |
| nbflocation not on record | 2 |
| WTUlocation not on record | 2 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 2 |
| Frauenfeld, CH | 2 |
| OLAlocation not on record | 2 |
| BG-NMNHSlocation not on record | 2 |
| National Museum Waleslocation not on record | 2 |
| College of the Atlantic, Museumlocation not on record | 2 |
| Gijón, ES | 2 |
| Nanjing, CN | 2 |
| Dresden, DE | 2 |
| US | 1 |
| Fulda, DE | 1 |
| Davenport, US | 1 |
| Bloomington, US | 1 |
| Göteborg, SE | 1 |
| IPE-CSIClocation not on record | 1 |
| PRClocation not on record | 1 |
| Arequipa, PE | 1 |
| GJOlocation not on record | 1 |
| Dekalb, US | 1 |
| Helsinki, FI | 1 |
| Uniwersytet w Białymstokulocation not on record | 1 |
| Musee National d'histoire Naturelle Luxembourglocation not on record | 1 |
| Sede di Via Giorgio La Pira del Museo di Storia naturale di Firenze | Via Giorgio La Pira headquarter of the Natural History Museum in Florencelocation not on record | 1 |
| Monastir, TN | 1 |
| BGBMlocation not on record | 1 |
| Royal Botanic Garden Edinburghlocation not on record | 1 |
| Namur, BE | 1 |
| Herbarium of South China Botanical Gardenlocation not on record | 1 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 1 |
| Honolulu, US | 1 |
| Taiyuan Normal Universitylocation not on record | 1 |
| University of Alberta Museumslocation not on record | 1 |
| FLADlocation not on record | 1 |
| UNINE:NEUlocation not on record | 1 |
| University of Guelph, OAC Herbariumlocation not on record | 1 |
| Herb. BBGlocation not on record | 1 |
| LfUlocation not on record | 1 |
| Wuzhou, CN | 1 |
| Kew, GB | 1 |
| ZRC-SAZUlocation not on record | 1 |
| Sant Julià de Lòria, AD | 1 |
| Madrid, ES | 1 |
| The State Museum-Preserve "The Kulikovo pole"location not on record | 1 |
| Urumqi, CN | 1 |
| NoColllocation not on record | 1 |
| Saint Louis, US | 1 |
154 institutions · 11 109 of 11 821 vouchered records shown · 543 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA20 detections
Where the DNA of Angelica sylvestris was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found20
Studies independent surveys1
Countries7
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 20 detections have coordinates
Open the map7 countries0
in tall grass meadow
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median14.3 °C 4.90–17.5
Seasonal swing summer↔winter15.9 °C
Max temp (day)17.2 °C 6.90–21.6
Min temp (night)10.9 °C 2.50–12.6
Precipitation85.8 mm/mo 71.3–168
Air humidity63.0 % 60.1–66.8
Moisture balance9.30 mm/mo -38.0–162
Vapour deficit596 Pa 307–794
Wind speed3.50 m/s 2.60–6.80
Cloud cover51.2 % 37.9–63.0
CHELSA 1981–2010, ~9 km grid, at location & month of 16 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.