Angelica pachycarpa

Lange · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Apiales/Apiaceae/Angelica

At a glance

Occurrence records729

Data sources11

Biological traits22

DNA specimens0

eDNA detections0

Sources11 archives

Databases and archives Angelica pachycarpa's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility729 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources22 traits

Chemical compositionLOTUS · NPASS22 compounds

Occurrence & distributionGBIF729 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 22

01Narrative

Angelica pachycarpa, the Portuguese angelica, is a herbaceous perennial plant native to north western Spain and western Portugal, and naturalized in New Zealand. It inhabits forests, grasslands and stream sides and is occasionally grown as an ornamental garden subject for its glossy foliage and umbels of white flowers.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology10

Fruit length10 mm

Leaf length max70 mm

Plant height0.6 m

Plant height max1 m

Seed length10 mm

Seed length max10 mm

Seed length min10 mm

Seed mass3.36 mg

Seed mass max3.36 mg

Seed mass min3.36 mg

Life cycle & reproduction7

Deciduousnessvariable

Dispersal typeunspecialized

Life formperennial

Life spanperennial

Lifespan years2 years

Raunkiær life formphanerophyte

Reproduction asexualabsent

Habitat & environment4

Climatetemperate

Growth formherb

⚠ sources differ — GIFT: herb · TRY: herb/non-woody

Habitat GIFTCoastal

Woodinessnon-woody

Physiology & chemistry1

Nitrogen fixingnon_nitrogen_fixer

03Chemical composition22 compounds

Compounds documented for Angelica pachycarpa across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Furocoumarins9

Furocoumarins $ Simple coumarins6

Simple coumarins5

Aporphine alkaloids $ Isoquinoline alkaloids1

Cinnamic acids and derivatives $ Simple phenolic acids1

Documented compounds22 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Boldine	present	NPASS
(+)-Byakangelicin	present	LOTUS
(+)-Marmesin	present	LOTUS
4-[(2S)-2-methoxy-3-methylbutoxy]furo[3,2-g]chromen-7-one	present	LOTUS
4-methoxy-9-[(2S)-2-methoxy-3-methylbutoxy]furo[3,2-g]chromen-7-one	present	LOTUS
7-[(2Z,6Z)-3,7,11-trimethyldodeca-2,6,10-trienoxy]chromen-2-one	present	LOTUS
7-Farnesyloxy-coumarin	present	LOTUS
9-[(2S)-2-hydroxy-3-methoxy-3-methylbutoxy]-4-methoxyfuro[3,2-g]chromen-7-one	present	LOTUS
9-[(2S)-2-hydroxy-3-methylbut-3-enoxy]-4-methoxyfuro[3,2-g]chromen-7-one	present	LOTUS
[(1S)-3-hydroxy-1-(4-methoxy-7-oxofuro[3,2-g]chromen-9-yl)oxy-3-methylbutyl] acetate	present	LOTUS

05DNA & barcoding10 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Angelica pachycarpa has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences10

Countries3

The DNA barcodea real sequence read deposited for this species

ITSMT735506.1 ↗599 bpUSA · 2000

ACGT

TCGAATCCTGCAATAGCAGAATGACCCGCTAACACGTTAACAATTTGGGCGAGCGTCGGGGGGCCTCGGTCTCCTGTCTGCGAATCCTTG …

Angelica pachycarpa voucher A.J. Healy 143831 (ISU1129) internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Angelica pachycarpa carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidydiploid inferred

Chromosome records22–222n range22median22mode8records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 228×CCDB · iber-fl · CCDB · nw-europe-fl · CCDB · ipcn-api-dl +1

CCDB · iber-fl — Estudio biosistemtico de las especies del gnero Angelica L. de la pennsula Ibrica. Madrid. Gutierrez Bustillo, A. M.*(1982).

CCDB · iber-fl — Estudio citotaxonmico de la flora de las costas gallegas Lago Canzobre, E. & S. Castroviejo.Cadernos rea Ci. Biol.3: 1-215(1993).

CCDB · iber-fl — Nmeros cromosmicos para la flora espaola, 93-94. Fernndez Casas, J. & M. E. Snchez Garca.Lagascalia9(1): 119-120(1979).

CCDB · iber-fl — Revisin del gnero Angelica (Umbelliferae) en la pennsula Ibrica. Gutierrez Bustillo, A. M.Lazaroa3: 137-161(1981).

CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=3302

CCDB · ipcn-api-dl — Fernandez Casas, J. & M. E. S. Garcia. 1979. In Numeros cromosomicos para la flora Espanola. 84-120. Lagascalia 9: 115–130.

CCDB · book-atlas-flowering-plants — Vaarama 1947a

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=0.960 ↗

08Occurrence & distribution

Record type729 records

Wild obs. + sensor631

Museum / vouchered84

Cultivated / captive14

Origin

Native1

Introduced3

Range

Area of Occupancy AOO1 392 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy68% within 1 km

≤100 m 277≤1 km 48≤10 km 151>10 km 4

480 georeferenced · 151 without coordinates

Open the mapobservation + sensor631

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy92% within 1 km

≤100 m 4≤1 km 7≤10 km 1

12 georeferenced · 72 without coordinates

Open the institutions mapphysical evidence84

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 14 records without

Open the mapnot free-living14

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Christchurch, NZ	31
Auckland, NZ	19
Wellington, NZ	11
MAlocation not on record	7
Rotorua, NZ	3
Museo Entomologico de Leonlocation not on record	2
ISAlocation not on record	2
BClocation not on record	2
Entomological Society of Latvialocation not on record	2
Hobart, AU	1
Moscow State Universitylocation not on record	1
JBAlocation not on record	1
Salamanca, ES	1
Alicante, ES	1

14 institutions · 84 of 84 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)