Angelica kingii

(S.Watson) J.M.Coult. & Rose · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Apiales/Apiaceae/Angelica

At a glance

Occurrence records126

Data sources8

Biological traits12

DNA specimens0

eDNA detections0

Sources8 archives

Databases and archives Angelica kingii's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility126 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources12 traits

Occurrence & distributionGBIF126 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 44

01Narrative

Angelica kingii is a species of angelica known as King's angelica. It is native to the western United States, especially the Great Basin region. This is a taprooted perennial herb varying in shape and size. It produces an erect, hollow stem to heights between 30 centimeters and two meters. The large leaves are composed of many lance-shaped leaflets each up to 12 centimeters in length. The inflorescence is a compound umbel with up to 14 long rays each holding clusters of small hairy flowers. The fruit is a pair of bodies about half a centimeter long each containing a seed.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass2.72 mg

Seed mass max2.72 mg

Seed mass min2.72 mg

Life cycle & reproduction2

Life formperennial

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding4 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Angelica kingii has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences4

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMT735501.1 ↗600 bpUSA · 1984

ACGT

TCGAATCCTGCAATAGCAGAATGACCCGCTAACACGTTAACAATTTGGGCGAGCGTCGGGGGGCCTCAGTCTCCTGTCTGCGAATCCCTG …

Angelica kingii voucher A. Tiehm 9191 (RM359142) internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS4

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Angelica kingii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 44 n = 22

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 221×CCDB · book-ipcn73-74

CCDB · book-ipcn73-74 — REVEAL, J.L., & E.L. STYER. 1973. Miscellaneous chromosome counts of western American plants - II. Great Basin Naturalist 33: 19-25.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type126 records

Wild obs. + sensor29

Museum / vouchered97

Range

Area of Occupancy AOO336 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy62% within 1 km

≤100 m 16>10 km 10

26 georeferenced · 3 without coordinates

Open the mapobservation + sensor29

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy83% within 1 km

≤100 m 2≤1 km 27≤10 km 5>10 km 1

35 georeferenced · 62 without coordinates

Open the institutions mapphysical evidence97

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions18 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bronx, US	22
Claremont, US	13
Henderson, US	11
Provo, US	9
Riverside, US	5
Orem, US	5
ASUlocation not on record	4
Caldwell, US	3
Logan, US	3
Flagstaff, US	2
Moscow, US	2
CASlocation not on record	1
Québec, CA	1
Phoenix, US	1
Boise, US	1
Davis, US	1
Eastern Nevada Landscape Coalitionlocation not on record	1
WTUlocation not on record	1
Museo Nacional de Costa Rica (MNCR)location not on record	1
San Luis Obispo, US	1
San Diego, US	1
Angwin, US	1
Bloomington, US	1

23 institutions · 91 of 97 vouchered records shown · 6 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)