Angelica hendersonii

J.M.Coult. & Rose · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Apiales/Apiaceae/Angelica

At a glance

Occurrence records1 627

Data sources6

Biological traits12

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Angelica hendersonii's data was compiled from.

GBIFGlobal Biodiversity Information Facility1 627 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements3 literature sources12 traits

Occurrence & distributionGBIF1 627 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 22

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass10.86 mg

Seed mass max10.86 mg

Seed mass min10.86 mg

Life cycle & reproduction2

Life formperennial

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding4 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Angelica hendersonii has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences4

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMT735454.1 ↗599 bpUSA · 1966

ACGT

TCGAATCCTGCAATAGCAGACTGACCCGCTAACACGTTAACAATTTGGGCGAGCGTCGGGGGGCCTCGGTCTCCTGACTGCGAATCCCTG …

Angelica hendersonii voucher Tracey & V. Call 2071 (OBI09030) internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS4

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Angelica hendersonii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 111×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Constance, L., T. i. Chuang & C. R. Bell. 1976. Chromosome numbers in Umbelliferae. V. Amer. J. Bot. 63(5): 608–625.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=0.960 ↗

08Occurrence & distribution

Record type1 627 records

Wild obs. + sensor1 508

Museum / vouchered119

Range

Area of Occupancy AOO1 508 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 961≤1 km 165≤10 km 66>10 km 35

1 227 georeferenced · 281 without coordinates

Open the mapobservation + sensor1 508

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy71% within 1 km

≤100 m 4≤1 km 65≤10 km 26>10 km 2

97 georeferenced · 22 without coordinates

Open the institutions mapphysical evidence119

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Arcata, US	24
Corvallis, US	18
Canadian Department of Agriculturelocation not on record	10
Davis, US	7
Pullman, US	7
CASlocation not on record	5
Wuzhou, CN	3
Portland, US	3
Riverside, US	2
Fort Bragg, US	2
San Francisco, US	2
Chicago, US	2
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	2
Angwin, US	2
WTUlocation not on record	1
Bronx, US	1
San Luis Obispo, US	1

17 institutions · 92 of 119 vouchered records shown · 27 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Angelica hendersonii

At a glance

Sources6 archives

Size & morphology3

Life cycle & reproduction2

Diet & foraging1

Habitat & environment6

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 627 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions13 of 17 geolocated

Record type1 627 records