Aneurus laevis

(Fabricius, 1775) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Aradidae/Aneurus

At a glance

Occurrence records508

Data sources7

Biological traits0

DNA specimens77

eDNA detections13

Sources7 archives

Databases and archives Aneurus laevis's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility508 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI13 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics77 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF508 records

Environmental DNA1 datasets · 6 countries13 detections

DNA & barcodingBOLD77 specimens

01Narrative

Aneurus laevis ist eine Wanzenart aus der Familie der Rindenwanzen (Aradidae).

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding77 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aneurus laevis has left across the world's sequence archives.

At a glance

DNA specimens77

BINs3

Marker genes1

eDNA detections13

Countries17

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus19 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 92% of positions are identical in every specimen.

Where individuals differ — all 55 variable positions, in barcode order

10Tmostly conserved

19Tmostly conserved

22Cvariable

58Amostly conserved

61Tmostly conserved

76Amostly conserved

112Tmostly conserved

127Cmostly conserved

163Amostly conserved

197Cvariable

205Cmostly conserved

214Tmostly conserved

220Gmostly conserved

226Tmostly conserved

238Amostly conserved

250Tmostly conserved

268Amostly conserved

271Cmostly conserved

289Gmostly conserved

292Gmostly conserved

298Avariable

302Cmostly conserved

313Tmostly conserved

319Tmostly conserved

325Tmostly conserved

340Cvariable

349Amostly conserved

367Tmostly conserved

430Gvariable

433Amostly conserved

436Tmostly conserved

457Tvariable

469Gmostly conserved

478Tmostly conserved

482Gvariable

484Gmostly conserved

487Amostly conserved

496Gmostly conserved

502Amostly conserved

517Amostly conserved

535Gvariable

538Amostly conserved

539Tmostly conserved

541Amostly conserved

544Amostly conserved

565Avariable

571Tmostly conserved

574Amostly conserved

580Gmostly conserved

619Cmostly conserved

625Amostly conserved

631Amostly conserved

634Cmostly conserved

652Tmostly conserved

653Cmostly conserved

AACTTTATATTTCATATTTGGCATATGATCAGGGATAGTAGGCACTTCCATAAGATGAATTATTCGAATCGAACTAGCCCAACCTGGGTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.8%

Haplotypes13

BINs3

Most divergent pair7.1%

AsiaEurope

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type508 records

Wild obs. + sensor390

Museum / vouchered113

Fossil2

Other3

Range

Area of Occupancy AOO1 360 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy58% within 1 km

≤100 m 115≤1 km 75≤10 km 133>10 km 3

326 georeferenced · 64 without coordinates

Open the mapobservation + sensor390

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy61% within 1 km

≤100 m 8≤1 km 15≤10 km 15

38 georeferenced · 75 without coordinates

Open the institutions mapphysical evidence113

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bavarian State Collection of Zoologylocation not on record	52
NHMOlocation not on record	17
Bonn, DE	16
CBDClocation not on record	8
SLU Artdatabankenlocation not on record	5
BioFokuslocation not on record	3
Research Collection of Ernst Heisslocation not on record	2
Helsinki, FI	1
NCMGlocation not on record	1
neflocation not on record	1

10 institutions · 106 of 113 vouchered records shown · 7 without an institution code

09Environmental DNA13 detections

Where the DNA of Aneurus laevis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found13

Studies independent surveys1

Countries6

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 13 detections have coordinates

Open the map6 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.7 °C 6.70–19.5

Seasonal swing summer↔winter21.4 °C

Max temp (day)19.4 °C 11.1–24.0

Min temp (night)9.00 °C 0.6–14.6

Precipitation56.4 mm/mo 11.0–114

Air humidity56.8 % 41.5–60.5

Moisture balance-40.4 mm/mo -92.6–-2.30

Vapour deficit777 Pa 434–1,014

Wind speed2.90 m/s 2.40–3.50

Cloud cover26.4 % 22.1–38.7

CHELSA 1981–2010, ~9 km grid, at location & month of 10 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)