Anethum graveolens
speciesAt a glance
Occurrence records10 173
Data sources15
Biological traits65
DNA specimens39
eDNA detections25
Sources15 archives
Databases and archives Anethum graveolens's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility10 173 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI25 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics39 specimens↗
NCBIUS National Library of Medicinesequences↗
FooDBThe Metabolomics Innovation Centrecompounds↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
giftgenome & karyotype
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources65 traits
Chemical compositionFooDB · LOTUS · NPASS5 898 compounds
Occurrence & distributionGBIF10 173 records
Environmental DNA1 datasets · 7 countries25 detections
DNA & barcodingBOLD · NCBI39 specimens
Genome at a glanceCCDB · GIFT · GoaT1.2 Gbp
01Narrative
L'aneth, Anethum graveolens, est une espèce de plantes herbacées de la famille des Apiacées (Ombellifères), du genre Anethum. Il est cultivé comme plante condimentaire pour ses feuilles et ses graines très aromatiques et se rapproche vaguement du fenouil par son odeur et ses propriétés, d'où ses autres noms de « fenouil bâtard » ou « faux anis ».
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDATRYWCVP
Size & morphology23
Fruit length4.75 mm
⚠ sources differ — AusTraits: 4.75 mm · GIFT: 4 mm
Fruit length max6 mm
Fruit length min3 mm
Fruit width2.25 mm
Fruit width max2.5 mm
Fruit width min2 mm
Inflorescence length max16 cm
Inflorescence length min7.0 cm
Leaf length16.5 mm
⚠ sources differ — AusTraits: 16.5 mm · GIFT: 12 mm
Leaf length max350 mm
Leaf length min4 mm
Leaf mass46.97 mg
Leaf size781 mm²
Leaf width5.25 mm
Leaf width max120 mm
Leaf width min100 mm
Plant height0.77 m
⚠ sources differ — GIFT: 0.77 m · AusTraits: 1.7 m · LEDA: 0.61 m · TRY: 0.7 m
Plant height generative0.67 m
Plant height max1.7 m
Plant height min0.4 m
Seed mass1.73 mg
⚠ sources differ — TRY: 1.73 mg · LEDA: 1.54 mg · GIFT: 1.72 mg
Seed mass max2.2 mg
Seed mass min1 mg
Life cycle & reproduction17
Deciduousnessevergreen
Dispersal typehemerochor
⚠ sources differ — LEDA: hemerochor · GIFT: unspecialized
Flower colourgreen
Flower length max1 mm
Flower length min0.5 mm
Flowering endSep
Flowering startJul
Flowering timeynnnnnnnnnnn
Life formannual
Life spanannual
Lifespan years1 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formtherophyte
Seed number525
Self fertilizationpresent
Sex typehermaphrodite
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment14
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max2 600 m
Elevation min0 m
Epiphyteterrestrial
Growth formherb
Habitat GIFTcropfields,inhabitedplaces,oldfields,parks
Leaf compoundnesscompound
Leaf formfiliform
Leaf shapestrap-shaped
Mycorrhiza type0.000000206
Succulenceno
Woodinessnon-woody
Physiology & chemistry4
Leaf dry-matter content (LDMC)160 mg/g
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Specific leaf area (SLA)18.46 mm²/mg
Other traits5
Diaspore typemericarp
Inflorescenceumbel
Plant support typefree-standing
Seeds per fruit>1000
Shoot orientationerect
03Chemical composition5 898 compounds
Compounds documented for Anethum graveolens across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
🍽 Used in cookingHerbs and Spices
Compound class profile5 classes
Aminoacids127
Cinnamic acids and derivatives86
Menthane monoterpenoids57
Glycerophospholipids57
Unsaturated fatty acids47
Documented compounds5 898 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| Retinol | 7,718 IU | FooDB | |
| 17alpha-ethynylestradiol | 4,450 mg/100g | FooDB | |
| Potassium | 4,257.5 mg/100g | FooDB | |
| Nitrogen | 3,200 mg/100 g | FooDB | |
| (R)-Carvone | 2,142.45 mg/100g | FooDB |
05DNA & barcoding39 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anethum graveolens has left across the world's sequence archives.
At a glance
DNA specimens39
Marker genes6
GenBank sequences10
eDNA detections25
Countries8
The DNA barcodea real sequence read deposited for this species
TTATGCGATTTCCTGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCAATAGGCCGAGGGCAC …
Anethum graveolens voucher PS0317MT01 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK1★rbcL5★rbcLa★ITS4★ITS1★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GIFT · GoaT · NCBI
The complete instruction manual Anethum graveolens carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size1 173 600 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Anethum graveolens1.17 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 22 n = 11
Ploidy2× diploid · measured
Chromosome records22–442n range22median22mode25records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 2224×GoaT · Kew Plant DNA C-values Database · CCDB · iber-fl · CCDB · nw-europe-fl +9
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · iber-fl — Chromosome atlas of flowering plants. Darlintong, C. D. & A. P. Wylie.*(1955).
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=3270
CCDB · poland — Pogan E., Czapik R., Jankun A., Kuta E. et al. 1982 a. Further studies in chromosome numbers of Polish Angiosperms. Part XV. Acta Biol. Cracov. Ser. Bot. 24, 91-126.
CCDB · ipcn-api-dl — Pogan, E., R. CZAPIK, A. Jankun & E. Kuta. 1982. Further studies in chromosome numbers of Polish angiosperms. Part XV. Acta Biol. Cracov., Ser. Bot. 24: 113–126.
CCDB · ipcn-api-dl — Hamal, I. A., A. LANGER & A. K. Koul. 1986. Nucleolar organizing region in the Apiaceae (Umbelliferae). Pl. Syst. Evol. 154: 11–30.
CCDB · ipcn-api-dl — Subramanian, D. 1986. Cytotaxonomical studies in south Indian Apiaceae. Cytologia 51: 479–488.
CCDB · ipcn-api-dl — Ma, X. H., R. L. Qin & W. B. Xing. 1984. Chromosome observations of some medical plants in Xinjiang. Acta Phytotax. Sin. 22: 243–249.
CCDB · ipcn-api-dl — Cauwet-Marc, A. M. 1982. In: IOPB chromosome number reports LXXVII. Taxon 31: 771–772.
CCDB · ipcn-api-dl — Carbonnier, J. & M. Farille. 1980. Contribution a l'etude caryologique des Ombelliferes du Nepal. I. Candollea 35:497–510.
CCDB · ipcn-api-dl — HINDAKOVA, M. 1978. In Index of chromosome numbers of Slovakian flora. Part 6. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 26: 1–42.
CCDB · ipcn-api-dl — Das, A. B. & R. Mallick. 1993. Nuclear DNA and chromosome changes within the tribe Amminae. Cytobios 74(298–299): 197–207.
CCDB · book-indian_vol1 — Melderis, A. 1930 ; Tamamshjan, S. (Fedorov); Delay, C. 1947; Reese, G. 1950; Suzuka, O. 1956; Kordyum, E.L. 1967
CCDB · book-indian_vol1 — Schulz-Gaebel, H. 1930
CCDB · book-fedorov — Schulz-Gaebel 1930
CCDB · book-atlas-flowering-plants — Tamamschjan 1933
CCDB · book-atlas-flowering-plants — Schulz-Gaebel 1930
CCDB · kew — Olszewska MJ, Osiecka R. 1983 Relationship between 2C DNA content, life-cycle, systematic position of DNA endoreplication dynamics in parenchyma nuclei during growth & differentiation of roots in dicot herbaceous sp. Biochem Physiol Pflanzen 178: 581-599
CCDB · Cave1956supp — Suzuka 1952-3
CCDB · CromoCat 2015 — Cauwet, A. M. (1982). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXVII]. Taxon 31(4): 771-772.
CCDB · CromoCat 2015 — Hamal, I. A., Langer, A. & Koul, A. K. (1986). Nucleolar organizing region in the Apiaceae (Umbelliferae) Pl. Syst. Evol. 154: 11–30
CCDB · CromoCat 2015 — Koul, A. K., Karihaloo, J. L. & Wakhlu, A. K. (1978). Spontaneous mixoploidy in Anethum graveolens L. J. Cytol. Genet. 13: 69–74
CCDB · CromoCat 2015 — Subramanian, D. (1986). Cytotaxonomical studies in south Indian Apiaceae Cytologia 51: 479–488
GIFT · GIFT (floras)
2n 441×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Koul, A. K., Karihaloo, J. L. & Wakhlu, A. K. (1978). Spontaneous mixoploidy in Anethum graveolens L. J. Cytol. Genet. 13: 69–74
n 116×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · book-ipcn75-78 +1
CCDB · ipcn-api-dl — Khatoon, S. & S. I. Ali. 1982. Chromosome numbers of some plants of Pakistan. Pakistan J. Bot. 14: 117–129.
CCDB · ipcn-api-dl — Carbonnier, J. & M. Farille. 1980. Contribution a l'etude caryologique des Ombelliferes du Nepal. I. Candollea 35:497–510.
CCDB · book-ipcn67-71 — KORDYUM, E. L. 1967. Cyto-embryology of Umbellates. (In Russian). Naukova Dumka, Kiev, 1967, 128pp.
CCDB · book-ipcn75-78 — Kaul et al. 1976a
CCDB · CromoCat 2015 — Carbonnier, J. & Farille, M. (1980). Contribution a l'etude caryologique des Ombelliferes du Nepal. I. Candollea 35:497–510
CCDB · CromoCat 2015 — Khatoon, S. & Ali, S. I. (1982). Chromosome numbers of some plants of Pakistan. Pak. J. Bot. 14: 117-129.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid2×GoaT · Kew Plant DNA C-values Database · GIFT · GIFT (floras)
GoaT · Kew Plant DNA C-values Database
GIFT · GIFT (floras)
diploid inferred1×PloiDB · family-scale
PloiDB · family-scale — chromEvol; reliability=0.960 ↗
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelScaffold
08Occurrence & distribution
Record type10 173 records
Wild obs. + sensor7 852
Museum / vouchered2 044
Cultivated / captive214
Other63
Origin
Native31
Introduced201
Range
Area of Occupancy AOO27 324 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy68% within 1 km
≤100 m 3 505≤1 km 855≤10 km 1 902>10 km 121
6 383 georeferenced · 1 469 without coordinates
Open the mapobservation + sensor7 852
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy46% within 1 km
≤100 m 143≤1 km 287≤10 km 445>10 km 66
941 georeferenced · 1 103 without coordinates
Open the institutions mapphysical evidence2 044
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy25% within 1 km
≤1 km 50≤10 km 142>10 km 7
199 georeferenced · 15 without coordinates
Open the mapnot free-living214
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions143 of 256 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| POL003location not on record | 177 |
| LDlocation not on record | 113 |
| Olocation not on record | 71 |
| Uniwersytet Wrocławskilocation not on record | 65 |
| Moscow State Universitylocation not on record | 58 |
| Oskarshamn, SE | 56 |
| HUN003location not on record | 56 |
| SLU Artdatabankenlocation not on record | 55 |
| Uniwersytet Warszawskilocation not on record | 49 |
| ROM007location not on record | 45 |
| Kuopio, FI | 38 |
| Uppsala, SE | 38 |
| Baroda, IN | 37 |
| Philadelphia, US | 35 |
| MeiseBGlocation not on record | 32 |
| Bronx, US | 28 |
| Berlin, DE | 25 |
| Barcelona, ES | 24 |
| Jyväskylä, FI | 22 |
| BDBClocation not on record | 21 |
| Oulu, FI | 20 |
| Tartu, EE | 19 |
| BFLlocation not on record | 17 |
| Saint Louis, US | 17 |
| València, ES | 16 |
| Provincia di Livornolocation not on record | 16 |
| Turku, FI | 15 |
| Adam Mickiewicz University in Poznańlocation not on record | 15 |
| MAlocation not on record | 15 |
| Nanjing, CN | 13 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 13 |
| Allentown, US | 12 |
| Universidad de Antioquia (UdeA)location not on record | 12 |
| ASUlocation not on record | 12 |
| Beijing, CN | 12 |
| Stockholm, SE | 12 |
| Chongqing Museumlocation not on record | 12 |
| Madison, US | 11 |
| Durango, MX | 11 |
| Universidad Industrial de Santander (UIS)location not on record | 11 |
| Auckland, NZ | 10 |
| BClocation not on record | 9 |
| Corvallis, US | 9 |
| Porvoo, FI | 9 |
| Trondheim, NO | 9 |
| Sanda, JP | 8 |
| Vitoria, ES | 8 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 8 |
| Bergen, NO | 8 |
| GZUlocation not on record | 8 |
| Görlitz, DE | 8 |
| BRNUlocation not on record | 7 |
| New Haven, US | 7 |
| Wuzhou, CN | 7 |
| Burlington, US | 7 |
| Brussel, BE | 7 |
| ROM020location not on record | 6 |
| Alicante, ES | 6 |
| Pullman, US | 6 |
| KMNlocation not on record | 6 |
| South Kensington, GB | 6 |
| Kunming, CN | 6 |
| DBF-NHMDlocation not on record | 6 |
| Spearfish, US | 6 |
| Mount Annan, AU | 6 |
| Ann Arbor, US | 6 |
| Yangling, CN | 6 |
| inatura Erlebnis Naturschau GmbHlocation not on record | 6 |
| Uniwersytet Śląski w Katowicachlocation not on record | 5 |
| TUR-Alocation not on record | 5 |
| Guilin, CN | 5 |
| AZE015location not on record | 5 |
| Universidad de Caldas (UCaldas)location not on record | 5 |
| Government College University Lahore, Dr. Sultan Ahmad Herbariumlocation not on record | 5 |
| Bloomington, US | 5 |
| Québec, CA | 4 |
| Salzburg, AT | 4 |
| TROMlocation not on record | 4 |
| TAFORI-LSRClocation not on record | 4 |
| St. Paul, US | 4 |
| Corrientes, AR | 4 |
| Guatemala, GT | 4 |
| Museo Achille Folettolocation not on record | 4 |
| Frauenfeld, CH | 4 |
| Chadron, US | 4 |
| Tokushima, JP | 4 |
| Philadelphia, US | 4 |
| Tallinn, EE | 4 |
| National Biodiversity Institute, Costa Ricalocation not on record | 4 |
| Santa Barbara, US | 4 |
| Adelaide, AU | 3 |
| Lanzhou, CN | 3 |
| Masindi, UG | 3 |
| Bourges, FR | 3 |
| Bern, CH | 3 |
| Entomological Society of Latvialocation not on record | 3 |
| UChlocation not on record | 3 |
| Universidade Federal de Sergipe (UFS)location not on record | 3 |
| Christchurch, NZ | 3 |
| Shanghai, CN | 3 |
| Salamanca, ES | 3 |
| Tampa, US | 3 |
| Austin, US | 3 |
| Riverside, US | 3 |
| Zürich, CH | 3 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 3 |
| Canberra, AU | 3 |
| CJBGlocation not on record | 3 |
| Bangkok, TH | 3 |
| Canadian Department of Agriculturelocation not on record | 3 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 3 |
| Vancouver, CA | 3 |
| Puerto Ayora, EC | 3 |
| Guangxi Institute of Traditional Medical and Pharmaceutical Scienceslocation not on record | 3 |
| Provo, US | 3 |
| Universidad Católica de Oriente (UCO)location not on record | 3 |
| Jaén, ES | 3 |
| Guatemala City, GT | 3 |
| San Diego, US | 3 |
| TAIElocation not on record | 2 |
| Tilburg, NL | 2 |
| Davenport, US | 2 |
| Universidad de Nariño (UdeNar)location not on record | 2 |
| Empresa Pernambucana de Pesquisa Agropecuária, IPAlocation not on record | 2 |
| Victoria, CA | 2 |
| Granada, ES | 2 |
| Universidad Nacional de Colombia (UNAL)location not on record | 2 |
| WINlocation not on record | 2 |
| Mexico City, MX | 2 |
| Tula State Universitylocation not on record | 2 |
| Natural History Museum Rotterdamlocation not on record | 2 |
| PrivatHerblocation not on record | 2 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 2 |
| Miami, US | 2 |
| University of Stellenboschlocation not on record | 2 |
| Fort Worth, US | 2 |
| Mlocation not on record | 2 |
| College Park, US | 2 |
| Western Carolina Universitylocation not on record | 2 |
| Columbia, US | 2 |
| Zürich, CH | 2 |
| Pamplona, ES | 2 |
| Antiguo Cuscatlán, SV | 2 |
| Riobamba, EC | 2 |
| Wlocation not on record | 2 |
| arosemena tola, EC | 2 |
| Pocatello, US | 2 |
| UNIVASFlocation not on record | 2 |
| BSBIlocation not on record | 2 |
| NMBU:MINAlocation not on record | 2 |
| Edinburgh, GB | 2 |
| US | 2 |
| Turlock, US | 2 |
| León, NI | 2 |
| Uniwersytet Opolskilocation not on record | 2 |
| Millersville, US | 2 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 2 |
| Karlsruhe, DE | 2 |
| Flagstaff, US | 2 |
| Université Lavallocation not on record | 2 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 2 |
| University of Guelph, OAC Herbariumlocation not on record | 2 |
| ROM023location not on record | 2 |
| BIO-UNIPIlocation not on record | 2 |
| Blumenau, BR | 2 |
| Chicago, US | 1 |
| PRClocation not on record | 1 |
| University of British Columbia, Herbariumlocation not on record | 1 |
| Northridge, US | 1 |
| Honolulu, US | 1 |
| Departamento de Sistematica e Ecologialocation not on record | 1 |
| Kew, GB | 1 |
| Ivano-Frankivsk, UA | 1 |
| University of New Hampshirelocation not on record | 1 |
| Chengdu, CN | 1 |
| Pelotas, BR | 1 |
| Montréal, CA | 1 |
| Pondicherry, IN | 1 |
| Universidade Federal de Juiz de Foralocation not on record | 1 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 1 |
| Alexandria Universitylocation not on record | 1 |
| Laboratorio de Ictiologialocation not on record | 1 |
| Wellington, NZ | 1 |
| Pretoria, ZA | 1 |
| GJOlocation not on record | 1 |
| Quito, EC | 1 |
| Phoenix, US | 1 |
| Museo Entomologico de Leonlocation not on record | 1 |
| McWane Science Centerlocation not on record | 1 |
| MKD001location not on record | 1 |
| Paris, FR | 1 |
| Universidad del Quindío (UniQuindío)location not on record | 1 |
| Córdoba, AR | 1 |
| Palacký University in Olomouclocation not on record | 1 |
| Yaoundé, CM | 1 |
| PUC-RSlocation not on record | 1 |
| Tromso University Museumlocation not on record | 1 |
| Fayetteville, US | 1 |
| Boise, US | 1 |
| Tacoma, US | 1 |
| Hudson, US | 1 |
| Ivano-Frankove, UA | 1 |
| Claremont, US | 1 |
| Salvador, BR | 1 |
| Moscow, US | 1 |
| Arcata, US | 1 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 1 |
| Bozeman, US | 1 |
| Dresden, DE | 1 |
| Los Angeles, US | 1 |
| Helsinki, FI | 1 |
| BGR001location not on record | 1 |
| San Francisco, US | 1 |
| Podgorica, ME | 1 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 1 |
| UESBlocation not on record | 1 |
| UFRPElocation not on record | 1 |
| Sri Ramaswamy Memorial Universitylocation not on record | 1 |
| GMBAlocation not on record | 1 |
| Irvine, US | 1 |
| San Luis Obispo, US | 1 |
| San Diego Natural History Museum, Herbariumlocation not on record | 1 |
| Severin-McDaniel Insect Collectionlocation not on record | 1 |
| Pontificia Universidad Javeriana (PUJ)location not on record | 1 |
| Arequipa, PE | 1 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 1 |
| MEXUlocation not on record | 1 |
| Sevilla, ES | 1 |
| Hermosillo, MX | 1 |
| National Institute for Agricultural and Veterinarian Research, Portugallocation not on record | 1 |
| Universidade Federal do Vale do São Franciscolocation not on record | 1 |
| UFPElocation not on record | 1 |
| AZE014location not on record | 1 |
| CICYTEXlocation not on record | 1 |
| UTPLlocation not on record | 1 |
| Instituto de Investigaciones Biológicas, Universidad Veracruzana, Región Xalapalocation not on record | 1 |
| Teresina, BR | 1 |
| University of Agriculture, Faisalabadlocation not on record | 1 |
| Istituto Agrario Castelnuovolocation not on record | 1 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 1 |
| Montréal, CA | 1 |
| BISHlocation not on record | 1 |
| Guangzhou, CN | 1 |
| Plocation not on record | 1 |
| Clemson, US | 1 |
| Denver, US | 1 |
| UFBAlocation not on record | 1 |
| Strecker Museum, Baylor Universitylocation not on record | 1 |
| Göteborg, SE | 1 |
| Appalachian State Universitylocation not on record | 1 |
| Williamsburg, US | 1 |
| Urumqi, CN | 1 |
| Frankfurt am Main | 1 |
| Xinjiang Institute of Ecology and Geography, Chinese Academy of Scienceslocation not on record | 1 |
| Chaguaramas, TT | 1 |
| Calabar, NG | 1 |
256 institutions · 1 892 of 2 044 vouchered records shown · 120 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA25 detections
Where the DNA of Anethum graveolens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found25
Studies independent surveys1
Countries7
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 25 detections have coordinates
Open the map7 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median19.3 °C 2.80–26.0
Seasonal swing summer↔winter18.8 °C
Max temp (day)23.7 °C 5.80–31.1
Min temp (night)13.6 °C -0.4–18.7
Precipitation56.3 mm/mo 24.8–92.8
Air humidity56.2 % 44.1–61.4
Moisture balance-29.5 mm/mo -132–51.5
Vapour deficit894 Pa 358–1,911
Wind speed3.10 m/s 1.70–6.20
Cloud cover37.2 % 21.5–52.3
CHELSA 1981–2010, ~9 km grid, at location & month of 16 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.