Anestia semiochrea

Butler, 1886 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Erebidae/Anestia

At a glance

Occurrence records229

Data sources7

Biological traits0

DNA specimens93

eDNA detections92

Sources7 archives

Databases and archives Anestia semiochrea's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility229 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI92 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics93 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF229 records

Environmental DNA1 datasets · 1 countries92 detections

DNA & barcodingBOLD93 specimens

01Narrative

Anestia semiochrea, the marbled footman, is a moth of the subfamily Arctiinae first described by Arthur Gardiner Butler in 1886. It is found in Australian Capital Territory, Queensland and New South Wales. The female has only vestigial wings (it is brachypterous). The larvae feed on lichen.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding93 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anestia semiochrea has left across the world's sequence archives.

At a glance

DNA specimens93

BINs1

Marker genes1

eDNA detections92

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus87 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 11 variable positions, in barcode order

4Cmostly conserved

82Tvariable

85Tmostly conserved

184Gmostly conserved

226Tvariable

340Cmostly conserved

355Amostly conserved

367Cmostly conserved

433Amostly conserved

628Gvariable

631Tvariable

AACCTTATATTTTATTTTTGGAATTTGAGCTGGTATAGTAGGAACTTCCCTAAGATTACTAATTCGAGCTGAATTAGGTAGTCCTGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.68%

Haplotypes27

BIN1

Most divergent pair1.7%

Oceania

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Bocana manifestalissame family11.2%Cosmosoma angustimargosame family11.2%Leucotmemis nexasame family11.4%Cosmosoma braconoidessame family11.6%Cosmosoma watsonisame family11.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type229 records

Wild obs. + sensor169

Museum / vouchered60

Range

Area of Occupancy AOO488 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 72≤1 km 18≤10 km 2>10 km 7

99 georeferenced · 70 without coordinates

Open the mapobservation + sensor169

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy53% within 1 km

≤100 m 15≤1 km 1≤10 km 12>10 km 2

30 georeferenced · 30 without coordinates

Open the institutions mapphysical evidence60

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Sydney, AU	40
Museums Victorialocation not on record	6
DPIlocation not on record	5
Centre for Biodiversity Genomicslocation not on record	3
Australian National Insect Collectionlocation not on record	2
Research Collection of Donald Hobernlocation not on record	1

6 institutions · 57 of 60 vouchered records shown · 3 without an institution code

09Environmental DNA92 detections

Where the DNA of Anestia semiochrea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found92

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 92 detections have coordinates

Open the map1 country0

14. Artificial - Terrestrial | 14.5 Urban Ar…14. Artificial - Terrestrial|14.5 Urban Areas

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.8 °C 12.8–22.7

Seasonal swing summer↔winter14.5 °C

Max temp (day)21.6 °C 18.5–29.1

Min temp (night)11.7 °C 7.00–16.1

Precipitation48.1 mm/mo 22.0–70.0

Air humidity56.4 % 48.8–58.6

Moisture balance-65.8 mm/mo -177–-43.3

Vapour deficit813 Pa 634–1,457

Wind speed2.50 m/s 2.10–4.30

Cloud cover20.4 % 14.8–24.1

CHELSA 1981–2010, ~9 km grid, at location & month of 91 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)