Anerastia lotella

Hübner, 1813 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Pyralidae/Anerastia

At a glance

Occurrence records4 806

Data sources9

Biological traits0

DNA specimens72

eDNA detections78

Sources9 archives

Databases and archives Anerastia lotella's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 806 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI78 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics72 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF4 806 records

Environmental DNA1 datasets · 12 countries78 detections

DNA & barcodingBOLD72 specimens

Genome at a glanceGoaT · NCBI≈1.1 Gbp

01Narrative

Anerastia lotella is a species of snout moth in the genus Anerastia. It was described by Jacob Hübner in 1813. It is found in most of Europe,Fauna Europaea western Russia, Asia Minor, Iran and western Turkestan. It has also been recorded from most of Canada. The wingspan is 19–27 mm. Adults are on wing in July.UKMoths Figs.4larva after final moult 4a, 4b, 4c, 4d, 4e larval cases and cocoons The larvae feed on various Poaceae species, including Ammophila arenaria, Corynephorus canescens and Festuca ovina. They construct a silken gallery around the stem base and roots of their host plant. Larvae are mainly found in May and June and it is thought the species overwinters in the larval stage.Microlepidoptera.nl Pupation takes place in a silken cocoon in the soil near the food plant.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding72 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anerastia lotella has left across the world's sequence archives.

At a glance

DNA specimens72

BINs1

Marker genes1

eDNA detections78

Countries12

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus66 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 8 variable positions, in barcode order

55Tmostly conserved

81Tvariable

220Cmostly conserved

277Cvariable

292Tvariable

343Tvariable

486Tvariable

631Amostly conserved

AACTTTATATTTTATTTTTGGAATTTGATCAGGAATAGTAGGTACTTCTTTAAGTCTTCTTATTCGAGCTGAATTAGGAATCCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.60%

Haplotypes12

BIN1

Most divergent pair1.4%

EuropeN.AmericaAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Zophodiodes leucocostellasame family6.2%Ematheudes michaelshafferisame family6.4%Emmalocera depressellasame family6.5%Transcaspia repetekellasame family6.5%Emmalocera latilimbellasame family6.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Anerastia lotella carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈1 079 716 894 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Anerastia lotella1.08 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness98.6% BUSCO

08Occurrence & distribution

Record type4 806 records

Wild obs. + sensor3 561

Museum / vouchered1 227

Other18

Origin

Native51

Range

Area of Occupancy AOO5 528 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy44% within 1 km

≤100 m 730≤1 km 736≤10 km 1 876>10 km 26

3 368 georeferenced · 193 without coordinates

Open the mapobservation + sensor3 561

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy35% within 1 km

≤100 m 116≤1 km 225≤10 km 484>10 km 141

966 georeferenced · 261 without coordinates

Open the institutions mapphysical evidence1 227

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 37 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	634
DanishLepidopterologicalSocietylocation not on record	155
Tartu, EE	71
NHMOlocation not on record	47
St. Paul, US	35
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	32
SLU Artdatabankenlocation not on record	27
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	23
East Lansing, US	19
Nijmegen, NL	15
Adam Mickiewicz University in Poznańlocation not on record	15
Tallinn, EE	14
Natural History Museum Rotterdamlocation not on record	13
University of Alberta Museums (UAM)location not on record	10
Philadelphia, US	8
Provincia di Livornolocation not on record	7
University of Guelph, Centre for Biodiversity Genomicslocation not on record	6
Durban Natural Science Museumlocation not on record	6
ZMAAlocation not on record	4
Zoological Museum of the University of Chittagong, Bangladeshlocation not on record	4
Metsähallituslocation not on record	3
University of Kaiserslauternlocation not on record	3
South Kensington, GB	2
KIRMlocation not on record	2
ZSMlocation not on record	2
Bavarian State Collection of Zoologylocation not on record	2
Research Collection of Theo Gruenewaldlocation not on record	2
Kuopio, FI	2
Stockholm, SE	2
Uniwersytet Łódzkilocation not on record	1
Research Collection of Tatyana A. Trofimovalocation not on record	1
Rovaniemi, FI	1
Zürich, CH	1
NTNU-VMlocation not on record	1
CBDClocation not on record	1
Tiroler Landesmuseum Ferdinandeumlocation not on record	1
European Distributed Institute of Taxonomy (EDIT)location not on record	1

37 institutions · 1 173 of 1 227 vouchered records shown · 54 without an institution code

09Environmental DNA78 detections

Where the DNA of Anerastia lotella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found78

Studies independent surveys1

Countries12

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 78 detections have coordinates

Open the map12 countries0

floodplainForestdune field; aspen/sage/lupineRiparian Zone

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.5 °C -1.70–19.6

Seasonal swing summer↔winter24.1 °C

Max temp (day)17.8 °C 1.40–25.3

Min temp (night)10.2 °C -6.00–14.9

Precipitation62.8 mm/mo 29.6–101

Air humidity61.4 % 54.2–63.2

Moisture balance-36.3 mm/mo -83.3–25.9

Vapour deficit662 Pa 237–985

Wind speed3.20 m/s 1.70–5.20

Cloud cover42.1 % 33.3–51.0

CHELSA 1981–2010, ~9 km grid, at location & month of 78 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anerastia lotella

At a glance

Sources9 archives

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type4 806 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions12 of 37 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type4 806 records