Anemone trifolia

species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Ranunculales/Ranunculaceae/Anemone

At a glance

Occurrence records1 307

Data sources10

Biological traits9

DNA specimens2

eDNA detections0

Sources10 archives

Databases and archives Anemone trifolia's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 307 records↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Paleobiology DatabasePBDB consortiumfossil record↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources9 traits

Chemical compositionLOTUS1 compounds

Occurrence & distributionGBIF1 307 records

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 32

01Narrative

L’Anémone noble, encore appelée Anémone trifoliée, est une espèce de plante à fleur de la famille des Ranunculaceae. Elle ressemble à l'Anémone sylvie mais avec une répartition plus restreinte limitée au sud et au centre de l'Europe, du Portugal et l'Espagne jusqu'à la Hongrie et, localement, au nord, en Finlande, où on en trouve une petite population. On la trouve dans les forêts de feuillus et les sites rocheux jusqu'à 1 800 mètres d'altitude. Les populations portugaise et espagnole se distinguent des populations restantes.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTTRY

Size & morphology3

Plant height0.2 m

Plant height max0.3 m

Plant height min0.1 m

Life cycle & reproduction4

Flowering endJun

Flowering startMay

Life spanperennial

Raunkiær life formcryptophyte

Habitat & environment2

Growth formherb

Woodinessnon-woody

03Chemical composition1 compounds

Compounds documented for Anemone trifolia across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Documented compounds1 total

Tissue Source Quantified only

Compound	Class	Amount	Source
Protoanemonin		present	LOTUS

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anemone trifolia has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes4

GenBank sequences4

Countries1

The DNA barcodea real sequence read deposited for this species

ITSPP476553.1 ↗452 bp

ACGT

AATCCGGCGCAACTGGCGTCAAGGAAAACTTACCGGAAGCAAGGCGTCGGCTCGTTCGGCGCCGCGTATCCGAATACTCAAACGACTCTC …

Anemone trifolia voucher Prosser F. et al. 60 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL2★rbcLa★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Anemone trifolia carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 32 n = 16

Ploidypolyploid inferred

Chromosome records16–322n range32median32mode5records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 323×CCDB · ita-fl · CCDB · fl-europaea · CCDB · ipcn-api-dl

CCDB · ita-fl — HOFMANN A. - 1968. La sottospecie albida dell'Anemone trifolia, nuova per l'Italia.. Arch. Bot. (Forl) , 44: 203-212.

CCDB · fl-europaea — Mattick, 1950

CCDB · ipcn-api-dl — Druskovic, B. & M. Lovka. 1995. IOPB chromosome data 9. Int. Organ. Pl. Biosyst. Newslett. (Zurich) 24: 15–19.

2n 162×CCDB · ita-fl · CCDB · book-ipcn72

CCDB · ita-fl — GARBARI F., TORNADORE N. - 1972. Numeri cromosomici per la flora italiana:108-123.. Inform. Bot. Ital. , 4(1): 60-66.

CCDB · book-ipcn72 — GARBARI, F . & N TORNADORE. 1972. In Numeri cromosomici per la flora Italiana. Informatore Bot.--Ytal. 4: 45-66.

n 162×CCDB · ita-fl · CCDB · book-ipcn65

CCDB · ita-fl — FAVARGER C. - 1965. Notes de caryologie alpine. IV.. Bull. Soc. Neuchateloise Sci. Nat. , 88: 60.

CCDB · book-ipcn65 — Favarger 1965a

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 307 records

Wild obs. + sensor1 073

Museum / vouchered224

Other10

Origin

Native20

Range

Area of Occupancy AOO1 672 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 669≤1 km 98≤10 km 112>10 km 61

940 georeferenced · 133 without coordinates

Open the mapobservation + sensor1 073

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy41% within 1 km

≤100 m 8≤1 km 59≤10 km 48>10 km 47

162 georeferenced · 62 without coordinates

Open the institutions mapphysical evidence224

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 30 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
GJOlocation not on record	55
Helsinki, FI	45
Salzburg, AT	23
LDlocation not on record	16
BRNUlocation not on record	9
Institut und Museum fuer Geologie und Palaeontologielocation not on record	7
SZUlocation not on record	6
inatura Erlebnis Naturschau GmbHlocation not on record	5
Wlocation not on record	5
Oskarshamn, SE	5
Provincia di Livornolocation not on record	4
Dresden, DE	4
Görlitz, DE	4
ISAlocation not on record	3
Turku, FI	3
PRClocation not on record	3
MAlocation not on record	2
Adam Mickiewicz University in Poznańlocation not on record	2
Philadelphia, US	1
Berlin, DE	1
GZUlocation not on record	1
Oulu, FI	1
Jyväskylä, FI	1
Davenport, US	1
Frankfurt am Main	1
Bern, CH	1
Karlsruhe, DE	1
Natural History Museum Rotterdamlocation not on record	1
Auckland, NZ	1
ULBF-AGRlocation not on record	1

30 institutions · 213 of 224 vouchered records shown · 11 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anemone trifolia

At a glance

Sources10 archives

Size & morphology3

Life cycle & reproduction4

Habitat & environment2

Documented compounds1 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 307 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions15 of 30 geolocated

Record type1 307 records