Anemone oregana — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Ranunculales/Ranunculaceae/Anemone

At a glance

Occurrence records138

Data sources8

Biological traits7

DNA specimens0

eDNA detections0

Sources8 archives

Databases and archives Anemone oregana's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility138 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources7 traits

Occurrence & distributionGBIF138 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 16

01Narrative

Anemonoides oregana (commonly called Anemone oregana) is a species of flowering plant in the buttercup family known by the common names blue windflower, Oregon anemone, and western wood anemone. It is native to the forests of Washington, Oregon, and northern California in western North America, generally below 7000 feet elevation.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTTRY

Life cycle & reproduction1

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment5

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding3 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anemone oregana has left across the world's sequence archives.

At a glance

Marker genes3

GenBank sequences3

The DNA barcodea real sequence read deposited for this species

ITSPP476532.1 ↗453 bp

ACGT

AATTCGGCGCAACTGGCGTCAAGGAAAACTTACCGGAAGCAAGGCGTCGGCTCGTTCGGCGCCGCGTATCCGAATACTCAAACGACTCTC …

Anemonoides oregana voucher Halse R.R. 7918 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK1rbcL1ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Anemone oregana carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 161×CCDB · eflora

CCDB · eflora

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type138 records

Wild obs. + sensor1

Museum / vouchered137

Range

Area of Occupancy AOO456 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy57% within 1 km

≤100 m 9≤1 km 45≤10 km 36>10 km 4

94 georeferenced · 43 without coordinates

Open the institutions mapphysical evidence137

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions28 of 37 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	15
WTUlocation not on record	9
Portland, US	9
Angwin, US	7
Arcata, US	7
Portland, US	6
Cheney, US	5
CASlocation not on record	4
Pullman, US	4
Riverside, US	4
Bend, US	3
Tacoma, US	3
Pacific Lutheran Universitylocation not on record	3
STNFlocation not on record	2
Bloomington, US	2
Walla Walla, US	2
Tampa, US	1
Flagstaff, US	1
Oskarshamn, SE	1
Claremont, US	1
US	1
US	1
Vancouver, CA	1
San Francisco, US	1
Brookings, US	1
Northridge, US	1
Davis, US	1
AUAlocation not on record	1
Chongqing Museumlocation not on record	1
HJAEFlocation not on record	1
Auckland, NZ	1
Santa Barbara, US	1
Tempe, US	1
Orem, US	1
Santa Cruz, US	1
ASUlocation not on record	1
Missoula, US	1

37 institutions · 106 of 137 vouchered records shown · 31 without an institution code