Anemone multifida
Poir. · speciesAt a glance
Occurrence records7 075
Data sources11
Biological traits94
DNA specimens37
eDNA detections19
Sources11 archives
Databases and archives Anemone multifida's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility7 075 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI19 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics37 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources94 traits
Chemical compositionLOTUS6 compounds
Occurrence & distributionGBIF7 075 records
Environmental DNA1 datasets · 2 countries19 detections
DNA & barcodingBOLD · NCBI37 specimens
Genome at a glanceCCDB2n = 14
01Narrative
Anemone multifida là một loài thực vật có hoa trong họ Mao lương. Loài này được Poir. mô tả khoa học đầu tiên năm 1810.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTUSDATRY
Size & morphology4
Plant height0.61 m
Seed mass1.13 mg
⚠ sources differ — TRY: 1.13 mg · GIFT: 1.19 mg
Seed mass max1.13 mg
Seed mass min1.13 mg
Life cycle & reproduction24
After harvest regrowth rateRapid
Bloom periodEarly Summer
Coppice potentialNo
Flower colouryellow
Flower conspicuousYes
Fruit seed period beginSummer
Fruit seed period endFall
Growth rate USDARapid
Life formperennial
Life spanperennial
Lifespan categoryShort
Propagated by bare rootNo
Propagated by bulbNo
Propagated by containerYes
Propagated by cormNo
Propagated by cuttingsNo
Propagated by seedYes
Propagated by sodNo
Propagated by sprigsNo
Propagated by tubersNo
Resprout abilityNo
Seed spread rateRapid
Seedling vigorMedium
Vegetative spread rateRapid
Diet & foraging1
Parasiteindependent
Habitat & environment26
Active growth periodSpring and Summer
Adapted to coarse textured soilsYes
Adapted to fine textured soilsNo
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatNone
Climatetemperate
Climberself-supporting
Elevation max2 000 m
Elevation min0 m
Epiphyteterrestrial
Foliage colorGreen
Foliage porosity summerPorous
Foliage porosity winterPorous
Foliage textureCoarse
Fruit colourblack
Growth formherb
Growth form USDARhizomatous
Hedge toleranceLow
Known allelopathNo
Leaf retentionNo
Low growing grassNo
Root depth min6 in
Shape and orientationErect
Small grainNo
Woodinessnon-woody
Physiology & chemistry20
Anaerobic toleranceNone
C:N ratioLow
Caco3 toleranceNone
Cold stratification requiredYes
Drought toleranceLow
Fertility requirementLow
Fire resistantNo
Fire toleranceLow
Frost free days min120 days
Moisture useMedium
Nitrogen fixation levelNone
Photosynthetic pathwayC3
Precipitation max60 in
Precipitation min40 in
Protein potentialMedium
Salinity toleranceNone
Shade toleranceLow
Soil pH max7.5 pH
Soil pH min6 pH
Temperature min-23 °F
Uses & economy15
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityContracting Only
Fodder productNo
Lumber productNo
Naval store productNo
Nursery stock productNo
Palatable browse animalLow
Palatable graze animalLow
Palatable humanNo
Post productNo
Pulpwood productNo
Seeds per pound363 000 per lb
ToxicityNone
Veneer productNo
Other traits4
Fall conspicuousNo
Fruit seed abundanceHigh
Fruit seed conspicuousNo
Fruit seed persistenceNo
03Chemical composition6 compounds
Compounds documented for Anemone multifida across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile2 classes
Oleanane triterpenoids4
Unsaturated fatty acids1
Documented compounds6 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (2S,3S,4R,5R,6R)-6-[[(3S,4aR,6aR,6bS,8aS,12aS,14aR,14bR)-8a-carboxy-4,4,6a,6b,11,11,14b-heptamethyl-1,2,3,4a,5,6,7,8,9,10,12,12a,14,14a-tetradecahydropicen-3-yl]oxy]-3-[(2S,3R,4R,5R,6S)-3-[(2S,3R,4R,5S)-3,4-dihydroxy-5-(hydroxymethyl)oxolan-2-yl]oxy-4,5-dihydroxy-6-methyloxan-2-yl]oxy-4,5-dihydroxyoxane-2-carboxylic acid | present | LOTUS | |
| (4aS,6aR,6aS,6bR,8aR,10S,12aR,14bS)-10-[(2R,3R,4R,5S,6R)-5-[(2S,3R,4R,5R,6S)-3-[(2S,3R,4R,5S)-3,4-dihydroxy-5-(hydroxymethyl)oxolan-2-yl]oxy-4,5-dihydroxy-6-methyloxan-2-yl]oxy-3,4-dihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-2,2,6a,6b,9,9,12a-heptamethyl-1,3,4,5,6,6a,7,8,8a,10,11,12,13,14b-tetradecahydropicene-4a-carboxylic acid | present | LOTUS | |
| (4aS,6aR,6aS,6bR,8aR,10S,12aR,14bS)-2,2,6a,6b,9,9,12a-heptamethyl-10-[(2R,3R,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxy-1,3,4,5,6,6a,7,8,8a,10,11,12,13,14b-tetradecahydropicene-4a-carboxylic acid | present | LOTUS | |
| Gamma-Linolenic acid | present | LOTUS | |
| Narcissiflorine | present | LOTUS | |
| Ranunculin | present | LOTUS |
05DNA & barcoding37 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anemone multifida has left across the world's sequence archives.
At a glance
DNA specimens37
Marker genes6
GenBank sequences10
eDNA detections19
Countries3
The DNA barcodea real sequence read deposited for this species
AGCCTTTTTGGCCGAGGGCACGCCTGCCTGGGCGTCACACACAGCGTCGCCCCCACTAATCCCTCTGGATTGGATGGGGGCGGAGATTGG …
Anemone multifida voucher CCDB-18334-E9 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK2★rbcL3★rbcLa★trnL-F★ITS5★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB
The complete instruction manual Anemone multifida carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 14 n = 7
Ploidydiploid inferred
Chromosome records14–322n range14median14mode83records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1459×CCDB · ita-fl · CCDB · slov-fl · CCDB · iapt +13
CCDB · ita-fl — MARCHI P. - 1963. Polimorfismo cariotipico nella popolazione di Anemone narcissiflora L. del "Corno alle Scale" (Appennino tosco-emiliano). I. Prime osservazioni.. Caryologia , 16(1): 121-126.
CCDB · slov-fl — Májovský J. et al., 1974a: Index of chromosome numbers of Slovakian flora (Part 3). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 22: 1-20.
CCDB · iapt
CCDB · poland — Mizianty M. and Frey L. 1973. Chromosome number of some vascular plants in the Western Bieszczady Mts (south-eastern Poland). Fragm. Flor. Geobot. 19, 265-270.
CCDB · poland — Trela Z. 1958. Cytological studies in species of the genus Anemone L. occurring in Poland. Acta Biol. Cracov. Ser. Bot. 1, 151-158.
CCDB · poland — Trela-Sawicka Z. 1976. Further embryological studies in the genus Anemone L. from Poland. Acta Biol. Cracov. Ser. Bot. 19, 83-92.
CCDB · ipcn-api-dl — Murin, A., I. Haberova & C. Zamsran. 1980. Karyological studies of some species of the Mongolian flora. Folia Geobot. Phytotax. 15: 395–405.
CCDB · ipcn-api-dl — Krogulevich, R. E. 1978. Kariologicheskij analiz vidov flory Vostochnogo Sajana. V Flora Pribajkal'ja. 19–48. Nauka, Novosibirsk.
CCDB · ipcn-api-dl — Dobea, C., B. Hahn & W. Morawetz. 1997. Chromosomenzahlen zur Gefässpflanzen-Flora Österreichs. Linzer Biol. Beitr. 29(1): 5–43.
CCDB · ipcn-api-dl — Mizianty, M. & L. Frey. 1973. Chromosome numbers of some vascular plants in the Western Bieszczady Mts. (South-eastern Poland). Fragm. Florist. Geobot. 19: 265–270.
CCDB · ipcn-api-dl — Yurtsev, B. A. & P. G. ZHUKOVA. 1982. Chromosome numbers of some plants of the northeastern Yakutia (the drainage of the Indigirka River in its middle reaches). Bot. Zhurn. 67 (6): 778–787. (In Russian).
CCDB · ipcn-api-dl — ZHUKOVA, P. G. & V. V. Petrovsky. 1980. Chromosome numbers and taxonomy of some species of the Anyui Mts. Bot. Zhurn. 65 (5): 651–659.
CCDB · ipcn-api-dl — Gurzenkov, N. N. 1973. Studies of chromosome numbers of plants from the south of the Soviet Far East. Komarov Lectures. 20: 47–61.
CCDB · ipcn-api-dl — Starodubtsev, V. N. 1989. Chromosome numbers in species of the families Aceraceae, Brassicaceae, Cyperaceae, Euphorbiaceae, Papaveraceae and Ranunculaceae from the Soviet far east. Bot. Žhurn. (Moscow & Leningrad) 74: 1674–1675.
CCDB · ipcn-api-dl — Starodubtsev, V. N. 1991. Vetren. Sist. Evol. Nauka, Leningrad.
CCDB · ipcn-api-dl — Nishikawa, T. 1988. Chromosome counts of flowering plants of Hokkaido (11). J. Hokkaido Univ. Educ., Sect. 2B 38: 33–40.
CCDB · book-ipcn72 — ROSTOVTSEVA, T.S., & V.V RUBTSOVA. 1972. A cariological study of some Siberian species of the genus Anemone L. (in Russian) Tsitologiya i Genetika 6: 118-121.
CCDB · book-ipcn67-71 — ZHUKOVA, P. G. 1967. Karyology of some plants, cultivated in the Arctic-Alpine Botanical Garden. (In Russian). In N. A. Avrorin (ed.): Plantarum in Zonam Polarem Transportatio. II. Leningrad 1967, pp. 139-149.
CCDB · book-ipcn67-71 — BAUMBERGER, H. 1970. Chromosomenzahlbestimmungen und Karyotypanalysen bei den Gattungen Anemone, Hepatica und Pulsatilla. Ber. Schweiz. Bot. Ges. 80: 17-96.
CCDB · book-ipcn67-71 — JOHNSON, A.W., & J.G. PACKER. 1968. Chromosome numbers in the flora of Ogotruk Creek, N.W. Alaska. Bot. Not. 121: 403-456.
CCDB · book-ipcn67-71 — KNABEN, G. 1968. Chromosome numbers of flowering plants from Central Alaska. Nytt mag. bot. 15: 240-254.
CCDB · book-ipcn67-71 — LEE, Y.N. 1969. Chromosome number of flowering plants in Korea (2) J. Korean Res. Inst. Better Living 2: 141-145.
CCDB · book-ipcn67-71 — KURITA, M. 1957. Chromosome studies in Ranunculaceae I. Karyotypes of the subtribe Anemoninae. Rep. Biol. Inst. Ehime Univ. 1: 1-10.
CCDB · book-ipcn67-71 — TAYLOR, R.L., & G.A. MULLIGAN. 1968. Flora of the Queen Charlotte Islands. Part 2. Cytological aspects of the Vascular Plants. Queen's Printer, Ottawa. pp. 148.
CCDB · book-ipcn67-71 — LOEVE, A, D. LOEVE, & B.M. KAPOOR. 1971. Cytotaxonomy of a century of Rocky Mountain orophytes. Arctic & Alpine Res. 3: 139-165.
CCDB · book-ipcn67-71 — SOKOLOVSKAYA, A.P. 1968. A karyological investigation Of the flora of the Korjakian Land. (In Russian) Bot. Zurn. 53: 99-105.
CCDB · book-ipcn75-78 — Vernigor 1977
CCDB · book-ipcn75-78 — Krogulevich 1978
CCDB · book-ipcn75-78 — Krogulevich 1976
CCDB · book-ipcn75-78 — Magulaev 1976
CCDB · book-ipcn75-78 — Belaeva & Siplivinsky 1975
CCDB · book-ipcn75-78 — Krogulevich 1971
CCDB · book-ipcn73-74 — CHUPOV, V.S. 1974. The materials on the geography of chromosome numbers in genera Anemone L., Pulsatilla Mill. and Hepatica Mill. Cidl Russian) Bot zurn. (Moscow & Leningrad) 59: 398-406. . I
CCDB · book-ipcn73-74 — MAKUSCHENKO, L.M. 1973. Chromosome numbers of some species in Ranunculaceae Juss. (in Russian) Bot. zurn. (Moscow & Leningrad) 58: 1023-1026.
CCDB · book-ipcn73-74 — KUPFER, P. 1974. Recherches sur les liens de parente entre la flore orophile des Alpes et celle des Pyrenees. Boissiera 23: 1-322.
CCDB · book-ipcn73-74 — MAJOVSKY, J., ET AL. 1974. Index of chromosome numbers of Slovakian flora. (Part 3). Acta Fac. Rerum Nat. Univ. Comenianae Bot. 22: 1-20.
CCDB · book-indian_vol1 — Langlet, O.F.J. 1932, 1936 ; Sakai, K. 1934; Gregory, W.C. 1941 ; Larsen, K. 1954a ; Kurita, M. 1955b, 1957a ; Trela, Z. 1958 ; Zhukova, P.G. 1967b ; Johnson, A.W. & Packer, J.G. 1968 ; Knaben, G. 1968 ; Lee, Y.N. 1969 ; Baumberger, Von H. 1971
CCDB · book-indian_vol1 — Heimburger, M. 1959 ; Zhukova, P.G. (Fedorov)
CCDB · eflora
CCDB · book-atlas-flowering-plants — Sakai 1934
+7 more references
2n 3213×CCDB · ipcn-api-dl · CCDB · book-ipcn66 · CCDB · book-ipcn67-71 +5
CCDB · ipcn-api-dl — Löve, A. & D. Löve. 1982. In: IOPB chromosome number reports LXXIV. Taxon 31: 120–126.
CCDB · ipcn-api-dl — Moore, D. M. 1981. Cromosome numbers of Fuegian angiosperms. Bol. Soc. Brot. 53: 995–1012.
CCDB · book-ipcn66 — Taylor & Brockman 1966
CCDB · book-ipcn67-71 — TAYLOR, R.L., & G.A. MULLIGAN. 1968. Flora of the Queen Charlotte Islands. Part 2. Cytological aspects of the Vascular Plants. Queen's Printer, Ottawa. pp. 148.
CCDB · book-ipcn67-71 — ZHUKOVA, P. G. 1967. Karyology of some plants, cultivated in the Arctic-Alpine Botanical Garden. (In Russian). In N. A. Avrorin (ed.): Plantarum in Zonam Polarem Transportatio. II. Leningrad 1967, pp. 139-149.
CCDB · book-indian_vol1 — Moffett, A.A. 1932a ; Zhukova, P.G. (Fedorov)
CCDB · eflora
CCDB · book-atlas-flowering-plants — Moffett 1932b
CCDB · book-atlas-flowering-plants
CCDB · Cave1959 — Heimburger 1959
CCDB · Cave1963 — Heimburger 1962
2n 1611×CCDB · iapt · CCDB · book-ipcn65 · CCDB · ipcn-api-dl +6
CCDB · iapt
CCDB · book-ipcn65 — Sokolovskaya 1965
CCDB · ipcn-api-dl — Murin, A., I. Haberova & C. Zamsran. 1980. Karyological studies of some species of the Mongolian flora. Folia Geobot. Phytotax. 15: 395–405.
CCDB · ipcn-api-dl — ZHUKOVA, P. G. 1980. Chromosome numbers of some Southern Chukotka plant species. Bot. Zhurn. 65 (1): 51–59.
CCDB · book-ipcn66 — Zhukova 1966
CCDB · book-ipcn67-71 — BAUMBERGER, H. 1970. Chromosomenzahlbestimmungen und Karyotypanalysen bei den Gattungen Anemone, Hepatica und Pulsatilla. Ber. Schweiz. Bot. Ges. 80: 17-96.
CCDB · book-indian_vol1 — Sokolovskaya, A.P. & Strelkova, O.S. (Fedorov)
CCDB · book-atlas-flowering-plants — S. & S. 1940
CCDB · Cave1958 — Sokolovskaya 1958
CCDB · Cave1963 — Sokol. & Strel. 1962
CCDB · iapt — IAPT/IOPB Chromosome Data 26
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type7 075 records
Wild obs. + sensor5 720
Museum / vouchered1 346
Cultivated / captive6
Fossil1
Other2
Origin
Native3
Introduced5
Range
Area of Occupancy AOO15 224 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy89% within 1 km
≤100 m 3 324≤1 km 661≤10 km 275>10 km 237
4 497 georeferenced · 1 223 without coordinates
Open the mapobservation + sensor5 720
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy43% within 1 km
≤100 m 62≤1 km 156≤10 km 262>10 km 32
512 georeferenced · 834 without coordinates
Open the institutions mapphysical evidence1 346
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy17% within 1 km
≤1 km 1≤10 km 5
6 georeferenced
Open the mapnot free-living6
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions72 of 112 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| University of Alberta Museumslocation not on record | 149 |
| Victoria, CA | 128 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 100 |
| Vancouver, CA | 61 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 61 |
| University of Lethbridgelocation not on record | 53 |
| Bronx, US | 48 |
| Denver, US | 41 |
| Chongqing Museumlocation not on record | 38 |
| WTUlocation not on record | 31 |
| Ann Arbor, US | 31 |
| Québec, CA | 27 |
| Bozeman, US | 25 |
| Provo, US | 25 |
| Moscow, US | 23 |
| Corvallis, US | 21 |
| Toronto, CA | 17 |
| University of Stellenboschlocation not on record | 16 |
| WINlocation not on record | 15 |
| Spearfish, US | 15 |
| San Isidro, AR | 15 |
| Brookings, US | 14 |
| Université Lavallocation not on record | 14 |
| Angwin, US | 13 |
| US | 13 |
| Rocky Mountain Biological Laboratorylocation not on record | 13 |
| Boise, US | 13 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 12 |
| Whitehorse, CA | 12 |
| Saint John, CA | 12 |
| Logan, US | 12 |
| Pullman, US | 11 |
| Yukon Universitylocation not on record | 10 |
| Saint Louis, US | 10 |
| Montréal, CA | 9 |
| Anchorage, US | 8 |
| Bloomington, US | 7 |
| Orem, US | 7 |
| ASUlocation not on record | 7 |
| Research Collection of B. A. Bennettlocation not on record | 6 |
| Flagstaff, US | 6 |
| Albuquerque, US | 6 |
| Riverside, US | 6 |
| Missoula, US | 6 |
| Paris, FR | 6 |
| Claremont, US | 6 |
| Churchill Northern Studies Centrelocation not on record | 5 |
| Kew, GB | 5 |
| San Luis Obispo, US | 5 |
| Tampa, US | 5 |
| Tacoma, US | 5 |
| Córdoba, AR | 5 |
| US | 4 |
| USFS/BHSClocation not on record | 4 |
| Acadia Universitylocation not on record | 4 |
| MeiseBGlocation not on record | 4 |
| University of New Hampshirelocation not on record | 4 |
| Moscow State Universitylocation not on record | 4 |
| DOI/NPS, Greenbelt Parklocation not on record | 4 |
| Pittsburg, US | 3 |
| Turlock, US | 3 |
| Ciudad Autónoma de Buenos Aires, AR | 3 |
| Wuzhou, CN | 3 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 3 |
| Madison, US | 3 |
| Lincoln, US | 3 |
| Corrientes, AR | 2 |
| Uppsala, SE | 2 |
| Edinburgh, GB | 2 |
| Meguro Parasitological Museumlocation not on record | 2 |
| Chadron, US | 2 |
| Grand Junction, US | 2 |
| Miami, US | 2 |
| The Manitoba Museum, Botany Departmentlocation not on record | 2 |
| Phoenix, US | 2 |
| Karlsruhe, DE | 2 |
| Yellowstone National Park Herbariumlocation not on record | 2 |
| MAlocation not on record | 2 |
| Pocatello, US | 2 |
| LPMMBHlocation not on record | 2 |
| Bangkok, TH | 2 |
| Burlington, US | 1 |
| Uniwersytet Śląski w Katowicachlocation not on record | 1 |
| Auckland, NZ | 1 |
| Frankfurt am Main | 1 |
| Henderson, US | 1 |
| Whitewater, US | 1 |
| Los Angeles, US | 1 |
| SLU Artdatabankenlocation not on record | 1 |
| Caldwell, US | 1 |
| Castelar, AR | 1 |
| St. Paul, US | 1 |
| BRNUlocation not on record | 1 |
| Universidad Nacional de Misiones- CONICETlocation not on record | 1 |
| Universidad Nacional de La Patagonialocation not on record | 1 |
| Santiago, CL | 1 |
| The University of Arizonalocation not on record | 1 |
| University of South Dakotalocation not on record | 1 |
| Chapel Hill, US | 1 |
| Turku, FI | 1 |
| University of British Columbia, Herbariumlocation not on record | 1 |
| Columbia, US | 1 |
| Research Collection of Jonathan Farrlocation not on record | 1 |
| UChlocation not on record | 1 |
| CJBGlocation not on record | 1 |
| Herbario Universidad de Concepciónlocation not on record | 1 |
| Beijing, CN | 1 |
| Royal Alberta Museumlocation not on record | 1 |
| Chicago, US | 1 |
| Oskarshamn, SE | 1 |
| Fullerton, US | 1 |
| Durango, US | 1 |
112 institutions · 1 319 of 1 346 vouchered records shown · 27 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA19 detections
Where the DNA of Anemone multifida was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found19
Studies independent surveys1
Countries2
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 19 detections have coordinates
Open the map2 countries0
Growing in meadow surrounding cabin
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median10.4 °C 2.90–15.1
Seasonal swing summer↔winter37.0 °C
Max temp (day)14.6 °C 7.60–21.1
Min temp (night)7.10 °C -3.10–9.10
Precipitation79.5 mm/mo 33.0–89.7
Air humidity60.8 % 51.6–62.8
Moisture balance-30.8 mm/mo -89.1–-7.40
Vapour deficit485 Pa 316–863
Wind speed2.70 m/s 2.10–7.70
Cloud cover43.9 % 36.1–46.0
CHELSA 1981–2010, ~9 km grid, at location & month of 15 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.