Anemone hortensis

species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Ranunculales/Ranunculaceae/Anemone

At a glance

Occurrence records13 890

Data sources10

Biological traits18

DNA specimens3

eDNA detections2

Sources10 archives

Databases and archives Anemone hortensis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility13 890 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Paleobiology DatabasePBDB consortiumfossil record↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources18 traits

Occurrence & distributionGBIF13 890 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB · GoaT12 Gbp

01Narrative

L'Anémone des jardins (Anemone hortensis L.) est une espèce de plante herbacée vivace de la famille des Ranunculaceae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTAusTraitsTRY

Size & morphology2

Plant height0.2 m

Seed mass0.982 mg

Life cycle & reproduction5

Dispersal typewind

Life formtuberous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typeachene

Growth formherb

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anemone hortensis has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences7

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSPP476518.1 ↗452 bp

ACGT

AATCCGGCGCAACCCGCGTCAAGGAAAACTCACCGGAAGCAAGGCGCCGGCCCGTCCGGCGCCGCGTATCCGAATACTCAAACGACTCTC …

Anemone hortensis voucher D. Marchetti 19993001 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL4★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Anemone hortensis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size12 042 722 755 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

THIS GENOME Anemone hortensis12.04 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidy2× diploid · measured

Chromosome records16–322n range16median16mode24records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 1623×GoaT · Kew Plant DNA C-values Database · CCDB · ita-fl · CCDB · mediterranean +5

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · ita-fl — MARCHI P. - 1971. Numeri cromosomici per la flora italiana:46-56.. Inform. Bot. Ital. , 3(1): 82-94.

CCDB · ita-fl — LARSEN K., LAEGAARD S. - 1971. Chromosome studies of the sicilian flora.. Bot. Tidsskr. , 66(3): 249-268.

CCDB · ita-fl — SIGNORINI M.A., MORI B. - 1994. Caryological observations on Anemone pavonina Lam. (Ranunculaceae) from Tuscany (Italy).. Caryologia , 47(2): 179-182.

CCDB · mediterranean

CCDB · ipcn-api-dl — MARKS, G. E. & D. Schweizer. 1974. Giemsa banding: karyotype differences in some species of Anemone and in Hepatica nobilis. Chromosoma 44: 405–416.

CCDB · ipcn-api-dl — Strid, A. & R. Franzen. 1981. In Chromosome number reports LXXIII. Taxon 30: 829–842.

CCDB · ipcn-api-dl — Unal, M. 1979. In IOPB chromosome number reports LXV. Taxon 28: 632.

CCDB · ipcn-api-dl — Tzanoudakis, D. 1986. Chromosome studies in the Greek flora I. Karyotypes of some Aegean angiosperms. Bot. Helv. 96: 27–36.

CCDB · ipcn-api-dl — Druskovic, B. & M. Lovka. 1995. IOPB chromosome data 9. Int. Organ. Pl. Biosyst. Newslett. (Zurich) 24: 15–19.

CCDB · ipcn-api-dl — Lovka, M. 1995. IOPB chromosome data 9. Int. Organ. Pl. Biosyst. Newslett. (Zurich) 24: 21–23.

CCDB · ipcn-api-dl — Milinarec, J. 2006. Ribosomal, telomeric and heterochromatin sequences localization in the karyotype of Anemone hortensis. Bot. J. Linn. Soc. 150: 177–186.

CCDB · book-ipcn67-71 — BAUMBERGER, H. 1970. Chromosomenzahlbestimmungen und Karyotypanalysen bei den Gattungen Anemone, Hepatica und Pulsatilla. Ber. Schweiz. Bot. Ges. 80: 17-96.

CCDB · book-ipcn67-71 — MADAHAR, C. 1967. Mediterranean and Asian taxa of Anemone (Section Eriocephalus) with tuberous rootstocks. Canad. Jour. Bot. 45: 725-735.

CCDB · book-ipcn67-71 — LARSEN, K., & s. LAGAARD. 1971. Chromosome studies of the Sicilian flora. Bot. Tidsskr. 66: 2Q9-268.

CCDB · book-ipcn67-71 — MARCHI, P. 1971. In Numeri cromosomici per la flora Italiana. Inf. Bot. Italiano 3: 47-94.

CCDB · book-atlas-flowering-plants — Langlet 1932

CCDB · kew — Mlinarec J, Chester M, Siljak-Yakovlev S, Papes D, Leitch AR, Besendorfer V. 2009. Molecular structure and chromosome distribution of three repetitive DNA families in Anemone hortensis L. (Ranunculaceae). Chromosome Research 17: 331-346.

CCDB · kew — Rothfels K, Sexsmith E, Heimburg.M, Krause MO. 1966. Chromosome size and DNA content of species of Anemone L and related genera (Ranunculaceae). Chromosoma 20: 54-74.

CCDB · iapt — IAPT/IOPB Chromosome Data 35

2n 321×CCDB · book-atlas-flowering-plants

CCDB · book-atlas-flowering-plants — Langlet 1932

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type13 890 records

Wild obs. + sensor13 764

Museum / vouchered125

Other1

Range

Area of Occupancy AOO20 028 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy78% within 1 km

≤100 m 7 260≤1 km 557≤10 km 2 109>10 km 103

10 029 georeferenced · 3 735 without coordinates

Open the mapobservation + sensor13 764

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy9% within 1 km

≤1 km 5≤10 km 44>10 km 5

54 georeferenced · 71 without coordinates

Open the institutions mapphysical evidence125

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions17 of 28 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museo Entomologico de Leonlocation not on record	43
Institut und Museum fuer Geologie und Palaeontologielocation not on record	23
Adam Mickiewicz University in Poznańlocation not on record	7
BClocation not on record	6
LDlocation not on record	5
Oskarshamn, SE	4
Bern, CH	3
Karlsruhe, DE	3
Wlocation not on record	3
Helsinki, FI	2
Tampa, US	2
CJBGlocation not on record	2
Logan, US	2
Sion, CH	1
Kew, GB	1
BRNUlocation not on record	1
Podgorica, ME	1
SNSNMClocation not on record	1
San Diego, US	1
Adelaide, AU	1
Tilburg, NL	1
Frankfurt am Main	1
Parkville, AU	1
Dresden, DE	1
GJOlocation not on record	1
Paris, FR	1
San Francisco, US	1
Muséum Henri Lecoqlocation not on record	1

28 institutions · 120 of 125 vouchered records shown · 5 without an institution code

09Environmental DNA2 detections

Where the DNA of Anemone hortensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anemone hortensis

At a glance

Sources10 archives

Size & morphology2

Life cycle & reproduction5

Diet & foraging1

Habitat & environment8

Physiology & chemistry1

Other traits1

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Record type13 890 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions17 of 28 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type13 890 records